Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items


study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

Product ID Name Sequence Format Price  
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
MIM0019 hsa-miR-1 Mimic UGGAAUGUAAAGAAGUAUGUAU 5 nmol $170 Buy Now
INH0019 hsa-miR-1 Inhibitor UGGAAUGUAAAGAAGUAUGUAU 5 nmol $170 Buy Now
MIM0020 hsa-miR-7-1-3p Mimic CAACAAAUCACAGUCUGCCAUA 5 nmol $170 Buy Now
INH0020 hsa-miR-7-1-3p Inhibitor CAACAAAUCACAGUCUGCCAUA 5 nmol $170 Buy Now
MIM0021 hsa-miR-7-2-3p Mimic CAACAAAUCCCAGUCUACCUAA 5 nmol $170 Buy Now
INH0021 hsa-miR-7-2-3p Inhibitor CAACAAAUCCCAGUCUACCUAA 5 nmol $170 Buy Now
MIM0022 hsa-miR-7-5p Mimic UGGAAGACUAGUGAUUUUGUUGU 5 nmol $170 Buy Now
INH0022 hsa-miR-7-5p Inhibitor UGGAAGACUAGUGAUUUUGUUGU 5 nmol $170 Buy Now
MIM0023 hsa-miR-9-3p Mimic AUAAAGCUAGAUAACCGAAAGU 5 nmol $170 Buy Now
INH0023 hsa-miR-9-3p Inhibitor AUAAAGCUAGAUAACCGAAAGU 5 nmol $170 Buy Now
MIM0024 hsa-miR-9-5p Mimic UCUUUGGUUAUCUAGCUGUAUGA 5 nmol $170 Buy Now
INH0024 hsa-miR-9-5p Inhibitor UCUUUGGUUAUCUAGCUGUAUGA 5 nmol $170 Buy Now
MIM0026 hsa-miR-10a-3p Mimic CAAAUUCGUAUCUAGGGGAAUA 5 nmol $170 Buy Now
INH0026 hsa-miR-10a-3p Inhibitor CAAAUUCGUAUCUAGGGGAAUA 5 nmol $170 Buy Now
MIM0028 hsa-miR-10a-5p Mimic UACCCUGUAGAUCCGAAUUUGUG 5 nmol $170 Buy Now
INH0028 hsa-miR-10a-5p Inhibitor UACCCUGUAGAUCCGAAUUUGUG 5 nmol $170 Buy Now
MIM0025 hsa-miR-10b-3p Mimic ACAGAUUCGAUUCUAGGGGAAU 5 nmol $170 Buy Now
INH0025 hsa-miR-10b-3p Inhibitor ACAGAUUCGAUUCUAGGGGAAU 5 nmol $170 Buy Now
MIM0027 hsa-miR-10b-5p Mimic UACCCUGUAGAACCGAAUUUGUG 5 nmol $170 Buy Now
INH0027 hsa-miR-10b-5p Inhibitor UACCCUGUAGAACCGAAUUUGUG 5 nmol $170 Buy Now
MIM0029 hsa-miR-15a-3p Mimic CAGGCCAUAUUGUGCUGCCUCA 5 nmol $170 Buy Now
INH0029 hsa-miR-15a-3p Inhibitor CAGGCCAUAUUGUGCUGCCUCA 5 nmol $170 Buy Now
MIM0031 hsa-miR-15a-5p Mimic UAGCAGCACAUAAUGGUUUGUG 5 nmol $170 Buy Now
INH0031 hsa-miR-15a-5p Inhibitor UAGCAGCACAUAAUGGUUUGUG 5 nmol $170 Buy Now
MIM0030 hsa-miR-15b-3p Mimic CGAAUCAUUAUUUGCUGCUCUA 5 nmol $170 Buy Now
INH0030 hsa-miR-15b-3p Inhibitor CGAAUCAUUAUUUGCUGCUCUA 5 nmol $170 Buy Now
MIM0032 hsa-miR-15b-5p Mimic UAGCAGCACAUCAUGGUUUACA 5 nmol $170 Buy Now
INH0032 hsa-miR-15b-5p Inhibitor UAGCAGCACAUCAUGGUUUACA 5 nmol $170 Buy Now
MIM0034 hsa-miR-16-1-3p Mimic CCAGUAUUAACUGUGCUGCUGA 5 nmol $170 Buy Now
INH0034 hsa-miR-16-1-3p Inhibitor CCAGUAUUAACUGUGCUGCUGA 5 nmol $170 Buy Now
MIM0033 hsa-miR-16-2-3p Mimic CCAAUAUUACUGUGCUGCUUUA 5 nmol $170 Buy Now
INH0033 hsa-miR-16-2-3p Inhibitor CCAAUAUUACUGUGCUGCUUUA 5 nmol $170 Buy Now
MIM0035 hsa-miR-16-5p Mimic UAGCAGCACGUAAAUAUUGGCG 5 nmol $170 Buy Now
INH0035 hsa-miR-16-5p Inhibitor UAGCAGCACGUAAAUAUUGGCG 5 nmol $170 Buy Now
MIM0036 hsa-miR-17-3p Mimic ACUGCAGUGAAGGCACUUGUAG 5 nmol $170 Buy Now
INH0036 hsa-miR-17-3p Inhibitor ACUGCAGUGAAGGCACUUGUAG 5 nmol $170 Buy Now
MIM0037 hsa-miR-17-5p Mimic CAAAGUGCUUACAGUGCAGGUAG 5 nmol $170 Buy Now
INH0037 hsa-miR-17-5p Inhibitor CAAAGUGCUUACAGUGCAGGUAG 5 nmol $170 Buy Now
MIM0038 hsa-miR-18a-3p Mimic ACUGCCCUAAGUGCUCCUUCUGG 5 nmol $170 Buy Now
INH0038 hsa-miR-18a-3p Inhibitor ACUGCCCUAAGUGCUCCUUCUGG 5 nmol $170 Buy Now
MIM0039 hsa-miR-18a-5p Mimic UAAGGUGCAUCUAGUGCAGAUAG 5 nmol $170 Buy Now
INH0039 hsa-miR-18a-5p Inhibitor UAAGGUGCAUCUAGUGCAGAUAG 5 nmol $170 Buy Now
MIM0041 hsa-miR-18b-3p Mimic UGCCCUAAAUGCCCCUUCUGGC 5 nmol $170 Buy Now
INH0041 hsa-miR-18b-3p Inhibitor UGCCCUAAAUGCCCCUUCUGGC 5 nmol $170 Buy Now
MIM0040 hsa-miR-18b-5p Mimic UAAGGUGCAUCUAGUGCAGUUAG 5 nmol $170 Buy Now
INH0040 hsa-miR-18b-5p Inhibitor UAAGGUGCAUCUAGUGCAGUUAG 5 nmol $170 Buy Now
MIM0046 hsa-miR-19a-3p Mimic UGUGCAAAUCUAUGCAAAACUGA 5 nmol $170 Buy Now
INH0046 hsa-miR-19a-3p Inhibitor UGUGCAAAUCUAUGCAAAACUGA 5 nmol $170 Buy Now
MIM0044 hsa-miR-19a-5p Mimic AGUUUUGCAUAGUUGCACUACA 5 nmol $170 Buy Now
INH0044 hsa-miR-19a-5p Inhibitor AGUUUUGCAUAGUUGCACUACA 5 nmol $170 Buy Now
MIM0042 hsa-miR-19b-1-5p Mimic AGUUUUGCAGGUUUGCAUCCAGC 5 nmol $170 Buy Now
INH0042 hsa-miR-19b-1-5p Inhibitor AGUUUUGCAGGUUUGCAUCCAGC 5 nmol $170 Buy Now
MIM0043 hsa-miR-19b-2-5p Mimic AGUUUUGCAGGUUUGCAUUUCA 5 nmol $170 Buy Now
INH0043 hsa-miR-19b-2-5p Inhibitor AGUUUUGCAGGUUUGCAUUUCA 5 nmol $170 Buy Now
MIM0045 hsa-miR-19b-3p Mimic UGUGCAAAUCCAUGCAAAACUGA 5 nmol $170 Buy Now
INH0045 hsa-miR-19b-3p Inhibitor UGUGCAAAUCCAUGCAAAACUGA 5 nmol $170 Buy Now
MIM0047 hsa-miR-20a-3p Mimic ACUGCAUUAUGAGCACUUAAAG 5 nmol $170 Buy Now
INH0047 hsa-miR-20a-3p Inhibitor ACUGCAUUAUGAGCACUUAAAG 5 nmol $170 Buy Now
MIM0050 hsa-miR-20a-5p Mimic UAAAGUGCUUAUAGUGCAGGUAG 5 nmol $170 Buy Now
INH0050 hsa-miR-20a-5p Inhibitor UAAAGUGCUUAUAGUGCAGGUAG 5 nmol $170 Buy Now
MIM0048 hsa-miR-20b-3p Mimic ACUGUAGUAUGGGCACUUCCAG 5 nmol $170 Buy Now
INH0048 hsa-miR-20b-3p Inhibitor ACUGUAGUAUGGGCACUUCCAG 5 nmol $170 Buy Now
MIM0049 hsa-miR-20b-5p Mimic CAAAGUGCUCAUAGUGCAGGUAG 5 nmol $170 Buy Now
INH0049 hsa-miR-20b-5p Inhibitor CAAAGUGCUCAUAGUGCAGGUAG 5 nmol $170 Buy Now
MIM0051 hsa-miR-21-3p Mimic CAACACCAGUCGAUGGGCUGU 5 nmol $170 Buy Now
INH0051 hsa-miR-21-3p Inhibitor CAACACCAGUCGAUGGGCUGU 5 nmol $170 Buy Now
MIM0052 hsa-miR-21-5p Mimic UAGCUUAUCAGACUGAUGUUGA 5 nmol $170 Buy Now
INH0052 hsa-miR-21-5p Inhibitor UAGCUUAUCAGACUGAUGUUGA 5 nmol $170 Buy Now
MIM0053 hsa-miR-22-3p Mimic AAGCUGCCAGUUGAAGAACUGU 5 nmol $170 Buy Now
INH0053 hsa-miR-22-3p Inhibitor AAGCUGCCAGUUGAAGAACUGU 5 nmol $170 Buy Now
MIM0054 hsa-miR-22-5p Mimic AGUUCUUCAGUGGCAAGCUUUA 5 nmol $170 Buy Now
INH0054 hsa-miR-22-5p Inhibitor AGUUCUUCAGUGGCAAGCUUUA 5 nmol $170 Buy Now
MIM0056 hsa-miR-23a-3p Mimic AUCACAUUGCCAGGGAUUUCC 5 nmol $170 Buy Now
INH0056 hsa-miR-23a-3p Inhibitor AUCACAUUGCCAGGGAUUUCC 5 nmol $170 Buy Now
MIM0057 hsa-miR-23a-5p Mimic GGGGUUCCUGGGGAUGGGAUUU 5 nmol $170 Buy Now
INH0057 hsa-miR-23a-5p Inhibitor GGGGUUCCUGGGGAUGGGAUUU 5 nmol $170 Buy Now
MIM0055 hsa-miR-23b-3p Mimic AUCACAUUGCCAGGGAUUACC 5 nmol $170 Buy Now
INH0055 hsa-miR-23b-3p Inhibitor AUCACAUUGCCAGGGAUUACC 5 nmol $170 Buy Now
MIM0058 hsa-miR-23b-5p Mimic UGGGUUCCUGGCAUGCUGAUUU 5 nmol $170 Buy Now
INH0058 hsa-miR-23b-5p Inhibitor UGGGUUCCUGGCAUGCUGAUUU 5 nmol $170 Buy Now
MIM0060 hsa-miR-24-1-5p Mimic UGCCUACUGAGCUGAUAUCAGU 5 nmol $170 Buy Now
INH0060 hsa-miR-24-1-5p Inhibitor UGCCUACUGAGCUGAUAUCAGU 5 nmol $170 Buy Now
MIM0059 hsa-miR-24-2-5p Mimic UGCCUACUGAGCUGAAACACAG 5 nmol $170 Buy Now
INH0059 hsa-miR-24-2-5p Inhibitor UGCCUACUGAGCUGAAACACAG 5 nmol $170 Buy Now
MIM0061 hsa-miR-24-3p Mimic UGGCUCAGUUCAGCAGGAACAG 5 nmol $170 Buy Now
INH0061 hsa-miR-24-3p Inhibitor UGGCUCAGUUCAGCAGGAACAG 5 nmol $170 Buy Now
MIM0063 hsa-miR-25-3p Mimic CAUUGCACUUGUCUCGGUCUGA 5 nmol $170 Buy Now
INH0063 hsa-miR-25-3p Inhibitor CAUUGCACUUGUCUCGGUCUGA 5 nmol $170 Buy Now
MIM0062 hsa-miR-25-5p Mimic AGGCGGAGACUUGGGCAAUUG 5 nmol $170 Buy Now
INH0062 hsa-miR-25-5p Inhibitor AGGCGGAGACUUGGGCAAUUG 5 nmol $170 Buy Now
MIM0065 hsa-miR-26a-1-3p Mimic CCUAUUCUUGGUUACUUGCACG 5 nmol $170 Buy Now
INH0065 hsa-miR-26a-1-3p Inhibitor CCUAUUCUUGGUUACUUGCACG 5 nmol $170 Buy Now
MIM0064 hsa-miR-26a-2-3p Mimic CCUAUUCUUGAUUACUUGUUUC 5 nmol $170 Buy Now
INH0064 hsa-miR-26a-2-3p Inhibitor CCUAUUCUUGAUUACUUGUUUC 5 nmol $170 Buy Now
MIM0067 hsa-miR-26a-5p Mimic UUCAAGUAAUCCAGGAUAGGCU 5 nmol $170 Buy Now
INH0067 hsa-miR-26a-5p Inhibitor UUCAAGUAAUCCAGGAUAGGCU 5 nmol $170 Buy Now
MIM0066 hsa-miR-26b-3p Mimic CCUGUUCUCCAUUACUUGGCUC 5 nmol $170 Buy Now
INH0066 hsa-miR-26b-3p Inhibitor CCUGUUCUCCAUUACUUGGCUC 5 nmol $170 Buy Now
MIM0068 hsa-miR-26b-5p Mimic UUCAAGUAAUUCAGGAUAGGU 5 nmol $170 Buy Now
INH0068 hsa-miR-26b-5p Inhibitor UUCAAGUAAUUCAGGAUAGGU 5 nmol $170 Buy Now
MIM0071 hsa-miR-27a-3p Mimic UUCACAGUGGCUAAGUUCCGC 5 nmol $170 Buy Now
INH0071 hsa-miR-27a-3p Inhibitor UUCACAGUGGCUAAGUUCCGC 5 nmol $170 Buy Now
MIM0070 hsa-miR-27a-5p Mimic AGGGCUUAGCUGCUUGUGAGCA 5 nmol $170 Buy Now
INH0070 hsa-miR-27a-5p Inhibitor AGGGCUUAGCUGCUUGUGAGCA 5 nmol $170 Buy Now
MIM0072 hsa-miR-27b-3p Mimic UUCACAGUGGCUAAGUUCUGC 5 nmol $170 Buy Now
INH0072 hsa-miR-27b-3p Inhibitor UUCACAGUGGCUAAGUUCUGC 5 nmol $170 Buy Now
MIM0069 hsa-miR-27b-5p Mimic AGAGCUUAGCUGAUUGGUGAAC 5 nmol $170 Buy Now
INH0069 hsa-miR-27b-5p Inhibitor AGAGCUUAGCUGAUUGGUGAAC 5 nmol $170 Buy Now
MIM0074 hsa-miR-28-3p Mimic CACUAGAUUGUGAGCUCCUGGA 5 nmol $170 Buy Now
INH0074 hsa-miR-28-3p Inhibitor CACUAGAUUGUGAGCUCCUGGA 5 nmol $170 Buy Now
MIM0073 hsa-miR-28-5p Mimic AAGGAGCUCACAGUCUAUUGAG 5 nmol $170 Buy Now
INH0073 hsa-miR-28-5p Inhibitor AAGGAGCUCACAGUCUAUUGAG 5 nmol $170 Buy Now
MIM0078 hsa-miR-29a-3p Mimic UAGCACCAUCUGAAAUCGGUUA 5 nmol $170 Buy Now
INH0078 hsa-miR-29a-3p Inhibitor UAGCACCAUCUGAAAUCGGUUA 5 nmol $170 Buy Now
MIM0075 hsa-miR-29a-5p Mimic ACUGAUUUCUUUUGGUGUUCAG 5 nmol $170 Buy Now
INH0075 hsa-miR-29a-5p Inhibitor ACUGAUUUCUUUUGGUGUUCAG 5 nmol $170 Buy Now
MIM0077 hsa-miR-29b-1-5p Mimic GCUGGUUUCAUAUGGUGGUUUAGA 5 nmol $170 Buy Now
INH0077 hsa-miR-29b-1-5p Inhibitor GCUGGUUUCAUAUGGUGGUUUAGA 5 nmol $170 Buy Now
MIM0076 hsa-miR-29b-2-5p Mimic CUGGUUUCACAUGGUGGCUUAG 5 nmol $170 Buy Now
INH0076 hsa-miR-29b-2-5p Inhibitor CUGGUUUCACAUGGUGGCUUAG 5 nmol $170 Buy Now
MIM0079 hsa-miR-29b-3p Mimic UAGCACCAUUUGAAAUCAGUGUU 5 nmol $170 Buy Now
INH0079 hsa-miR-29b-3p Inhibitor UAGCACCAUUUGAAAUCAGUGUU 5 nmol $170 Buy Now
MIM0080 hsa-miR-29c-3p Mimic UAGCACCAUUUGAAAUCGGUUA 5 nmol $170 Buy Now
INH0080 hsa-miR-29c-3p Inhibitor UAGCACCAUUUGAAAUCGGUUA 5 nmol $170 Buy Now
MIM0081 hsa-miR-29c-5p Mimic UGACCGAUUUCUCCUGGUGUUC 5 nmol $170 Buy Now
INH0081 hsa-miR-29c-5p Inhibitor UGACCGAUUUCUCCUGGUGUUC 5 nmol $170 Buy Now
MIM0087 hsa-miR-30a-3p Mimic CUUUCAGUCGGAUGUUUGCAGC 5 nmol $170 Buy Now
INH0087 hsa-miR-30a-3p Inhibitor CUUUCAGUCGGAUGUUUGCAGC 5 nmol $170 Buy Now
MIM0091 hsa-miR-30a-5p Mimic UGUAAACAUCCUCGACUGGAAG 5 nmol $170 Buy Now
INH0091 hsa-miR-30a-5p Inhibitor UGUAAACAUCCUCGACUGGAAG 5 nmol $170 Buy Now
MIM0084 hsa-miR-30b-3p Mimic CUGGGAGGUGGAUGUUUACUUC 5 nmol $170 Buy Now
INH0084 hsa-miR-30b-3p Inhibitor CUGGGAGGUGGAUGUUUACUUC 5 nmol $170 Buy Now
MIM0089 hsa-miR-30b-5p Mimic UGUAAACAUCCUACACUCAGCU 5 nmol $170 Buy Now
INH0089 hsa-miR-30b-5p Inhibitor UGUAAACAUCCUACACUCAGCU 5 nmol $170 Buy Now
MIM0083 hsa-miR-30c-1-3p Mimic CUGGGAGAGGGUUGUUUACUCC 5 nmol $170 Buy Now
INH0083 hsa-miR-30c-1-3p Inhibitor CUGGGAGAGGGUUGUUUACUCC 5 nmol $170 Buy Now
MIM0082 hsa-miR-30c-2-3p Mimic CUGGGAGAAGGCUGUUUACUCU 5 nmol $170 Buy Now
INH0082 hsa-miR-30c-2-3p Inhibitor CUGGGAGAAGGCUGUUUACUCU 5 nmol $170 Buy Now
MIM0090 hsa-miR-30c-5p Mimic UGUAAACAUCCUACACUCUCAGC 5 nmol $170 Buy Now
INH0090 hsa-miR-30c-5p Inhibitor UGUAAACAUCCUACACUCUCAGC 5 nmol $170 Buy Now
MIM0085 hsa-miR-30d-3p Mimic CUUUCAGUCAGAUGUUUGCUGC 5 nmol $170 Buy Now
INH0085 hsa-miR-30d-3p Inhibitor CUUUCAGUCAGAUGUUUGCUGC 5 nmol $170 Buy Now
MIM0088 hsa-miR-30d-5p Mimic UGUAAACAUCCCCGACUGGAAG 5 nmol $170 Buy Now
INH0088 hsa-miR-30d-5p Inhibitor UGUAAACAUCCCCGACUGGAAG 5 nmol $170 Buy Now
MIM0086 hsa-miR-30e-3p Mimic CUUUCAGUCGGAUGUUUACAGC 5 nmol $170 Buy Now
INH0086 hsa-miR-30e-3p Inhibitor CUUUCAGUCGGAUGUUUACAGC 5 nmol $170 Buy Now
MIM0092 hsa-miR-30e-5p Mimic UGUAAACAUCCUUGACUGGAAG 5 nmol $170 Buy Now
INH0092 hsa-miR-30e-5p Inhibitor UGUAAACAUCCUUGACUGGAAG 5 nmol $170 Buy Now
MIM0094 hsa-miR-31-3p Mimic UGCUAUGCCAACAUAUUGCCAU 5 nmol $170 Buy Now
INH0094 hsa-miR-31-3p Inhibitor UGCUAUGCCAACAUAUUGCCAU 5 nmol $170 Buy Now
MIM0093 hsa-miR-31-5p Mimic AGGCAAGAUGCUGGCAUAGCU 5 nmol $170 Buy Now
INH0093 hsa-miR-31-5p Inhibitor AGGCAAGAUGCUGGCAUAGCU 5 nmol $170 Buy Now
MIM0095 hsa-miR-32-3p Mimic CAAUUUAGUGUGUGUGAUAUUU 5 nmol $170 Buy Now
INH0095 hsa-miR-32-3p Inhibitor CAAUUUAGUGUGUGUGAUAUUU 5 nmol $170 Buy Now
MIM0096 hsa-miR-32-5p Mimic UAUUGCACAUUACUAAGUUGCA 5 nmol $170 Buy Now
INH0096 hsa-miR-32-5p Inhibitor UAUUGCACAUUACUAAGUUGCA 5 nmol $170 Buy Now
MIM0097 hsa-miR-33a-3p Mimic CAAUGUUUCCACAGUGCAUCAC 5 nmol $170 Buy Now
INH0097 hsa-miR-33a-3p Inhibitor CAAUGUUUCCACAGUGCAUCAC 5 nmol $170 Buy Now
MIM0100 hsa-miR-33a-5p Mimic GUGCAUUGUAGUUGCAUUGCA 5 nmol $170 Buy Now
INH0100 hsa-miR-33a-5p Inhibitor GUGCAUUGUAGUUGCAUUGCA 5 nmol $170 Buy Now
MIM0098 hsa-miR-33b-3p Mimic CAGUGCCUCGGCAGUGCAGCCC 5 nmol $170 Buy Now
INH0098 hsa-miR-33b-3p Inhibitor CAGUGCCUCGGCAGUGCAGCCC 5 nmol $170 Buy Now
MIM0099 hsa-miR-33b-5p Mimic GUGCAUUGCUGUUGCAUUGC 5 nmol $170 Buy Now
INH0099 hsa-miR-33b-5p Inhibitor GUGCAUUGCUGUUGCAUUGC 5 nmol $170 Buy Now
MIM0104 hsa-miR-34a-3p Mimic CAAUCAGCAAGUAUACUGCCCU 5 nmol $170 Buy Now
INH0104 hsa-miR-34a-3p Inhibitor CAAUCAGCAAGUAUACUGCCCU 5 nmol $170 Buy Now
MIM0106 hsa-miR-34a-5p Mimic UGGCAGUGUCUUAGCUGGUUGU 5 nmol $170 Buy Now
INH0106 hsa-miR-34a-5p Inhibitor UGGCAGUGUCUUAGCUGGUUGU 5 nmol $170 Buy Now
MIM0103 hsa-miR-34b-3p Mimic CAAUCACUAACUCCACUGCCAU 5 nmol $170 Buy Now
INH0103 hsa-miR-34b-3p Inhibitor CAAUCACUAACUCCACUGCCAU 5 nmol $170 Buy Now
MIM0105 hsa-miR-34b-5p Mimic UAGGCAGUGUCAUUAGCUGAUUG 5 nmol $170 Buy Now
INH0105 hsa-miR-34b-5p Inhibitor UAGGCAGUGUCAUUAGCUGAUUG 5 nmol $170 Buy Now
MIM0101 hsa-miR-34c-3p Mimic AAUCACUAACCACACGGCCAGG 5 nmol $170 Buy Now
INH0101 hsa-miR-34c-3p Inhibitor AAUCACUAACCACACGGCCAGG 5 nmol $170 Buy Now
MIM0102 hsa-miR-34c-5p Mimic AGGCAGUGUAGUUAGCUGAUUGC 5 nmol $170 Buy Now
INH0102 hsa-miR-34c-5p Inhibitor AGGCAGUGUAGUUAGCUGAUUGC 5 nmol $170 Buy Now
MIM0108 hsa-miR-92a-1-5p Mimic AGGUUGGGAUCGGUUGCAAUGCU 5 nmol $170 Buy Now
INH0108 hsa-miR-92a-1-5p Inhibitor AGGUUGGGAUCGGUUGCAAUGCU 5 nmol $170 Buy Now
MIM0109 hsa-miR-92a-2-5p Mimic GGGUGGGGAUUUGUUGCAUUAC 5 nmol $170 Buy Now
INH0109 hsa-miR-92a-2-5p Inhibitor GGGUGGGGAUUUGUUGCAUUAC 5 nmol $170 Buy Now
MIM0111 hsa-miR-92a-3p Mimic UAUUGCACUUGUCCCGGCCUGU 5 nmol $170 Buy Now
INH0111 hsa-miR-92a-3p Inhibitor UAUUGCACUUGUCCCGGCCUGU 5 nmol $170 Buy Now
MIM0110 hsa-miR-92b-3p Mimic UAUUGCACUCGUCCCGGCCUCC 5 nmol $170 Buy Now
INH0110 hsa-miR-92b-3p Inhibitor UAUUGCACUCGUCCCGGCCUCC 5 nmol $170 Buy Now
MIM0107 hsa-miR-92b-5p Mimic AGGGACGGGACGCGGUGCAGUG 5 nmol $170 Buy Now
INH0107 hsa-miR-92b-5p Inhibitor AGGGACGGGACGCGGUGCAGUG 5 nmol $170 Buy Now
MIM0112 hsa-miR-93-3p Mimic ACUGCUGAGCUAGCACUUCCCG 5 nmol $170 Buy Now
INH0112 hsa-miR-93-3p Inhibitor ACUGCUGAGCUAGCACUUCCCG 5 nmol $170 Buy Now
MIM0113 hsa-miR-93-5p Mimic CAAAGUGCUGUUCGUGCAGGUAG 5 nmol $170 Buy Now
INH0113 hsa-miR-93-5p Inhibitor CAAAGUGCUGUUCGUGCAGGUAG 5 nmol $170 Buy Now
MIM0114 hsa-miR-95 Mimic UUCAACGGGUAUUUAUUGAGCA 5 nmol $170 Buy Now
INH0114 hsa-miR-95 Inhibitor UUCAACGGGUAUUUAUUGAGCA 5 nmol $170 Buy Now
MIM0115 hsa-miR-96-3p Mimic AAUCAUGUGCAGUGCCAAUAUG 5 nmol $170 Buy Now
INH0115 hsa-miR-96-3p Inhibitor AAUCAUGUGCAGUGCCAAUAUG 5 nmol $170 Buy Now
MIM0116 hsa-miR-98 Mimic UGAGGUAGUAAGUUGUAUUGUU 5 nmol $170 Buy Now
INH0116 hsa-miR-98 Inhibitor UGAGGUAGUAAGUUGUAUUGUU 5 nmol $170 Buy Now
MIM0118 hsa-miR-99a-3p Mimic CAAGCUCGCUUCUAUGGGUCUG 5 nmol $170 Buy Now
INH0118 hsa-miR-99a-3p Inhibitor CAAGCUCGCUUCUAUGGGUCUG 5 nmol $170 Buy Now
MIM0117 hsa-miR-99a-5p Mimic AACCCGUAGAUCCGAUCUUGUG 5 nmol $170 Buy Now
INH0117 hsa-miR-99a-5p Inhibitor AACCCGUAGAUCCGAUCUUGUG 5 nmol $170 Buy Now
MIM0119 hsa-miR-99b-3p Mimic CAAGCUCGUGUCUGUGGGUCCG 5 nmol $170 Buy Now
INH0119 hsa-miR-99b-3p Inhibitor CAAGCUCGUGUCUGUGGGUCCG 5 nmol $170 Buy Now
MIM0120 hsa-miR-99b-5p Mimic CACCCGUAGAACCGACCUUGCG 5 nmol $170 Buy Now
INH0120 hsa-miR-99b-5p Inhibitor CACCCGUAGAACCGACCUUGCG 5 nmol $170 Buy Now