Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items


study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

Product ID Name Sequence Format Price  
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
MIM0122 hsa-miR-100-3p Mimic CAAGCUUGUAUCUAUAGGUAUG 5 nmol $170 Buy Now
INH0122 hsa-miR-100-3p Inhibitor CAAGCUUGUAUCUAUAGGUAUG 5 nmol $170 Buy Now
MIM0121 hsa-miR-100-5p Mimic AACCCGUAGAUCCGAACUUGUG 5 nmol $170 Buy Now
INH0121 hsa-miR-100-5p Inhibitor AACCCGUAGAUCCGAACUUGUG 5 nmol $170 Buy Now
MIM0124 hsa-miR-101-3p Mimic UACAGUACUGUGAUAACUGAA 5 nmol $170 Buy Now
INH0124 hsa-miR-101-3p Inhibitor UACAGUACUGUGAUAACUGAA 5 nmol $170 Buy Now
MIM0123 hsa-miR-101-5p Mimic CAGUUAUCACAGUGCUGAUGCU 5 nmol $170 Buy Now
INH0123 hsa-miR-101-5p Inhibitor CAGUUAUCACAGUGCUGAUGCU 5 nmol $170 Buy Now
MIM0128 hsa-miR-105-3p Mimic ACGGAUGUUUGAGCAUGUGCUA 5 nmol $170 Buy Now
INH0128 hsa-miR-105-3p Inhibitor ACGGAUGUUUGAGCAUGUGCUA 5 nmol $170 Buy Now
MIM0129 hsa-miR-105-5p Mimic UCAAAUGCUCAGACUCCUGUGGU 5 nmol $170 Buy Now
INH0129 hsa-miR-105-5p Inhibitor UCAAAUGCUCAGACUCCUGUGGU 5 nmol $170 Buy Now
MIM0132 hsa-miR-106a-3p Mimic CUGCAAUGUAAGCACUUCUUAC 5 nmol $170 Buy Now
INH0132 hsa-miR-106a-3p Inhibitor CUGCAAUGUAAGCACUUCUUAC 5 nmol $170 Buy Now
MIM0130 hsa-miR-106a-5p Mimic AAAAGUGCUUACAGUGCAGGUAG 5 nmol $170 Buy Now
INH0130 hsa-miR-106a-5p Inhibitor AAAAGUGCUUACAGUGCAGGUAG 5 nmol $170 Buy Now
MIM0131 hsa-miR-106b-3p Mimic CCGCACUGUGGGUACUUGCUGC 5 nmol $170 Buy Now
INH0131 hsa-miR-106b-3p Inhibitor CCGCACUGUGGGUACUUGCUGC 5 nmol $170 Buy Now
MIM0133 hsa-miR-106b-5p Mimic UAAAGUGCUGACAGUGCAGAU 5 nmol $170 Buy Now
INH0133 hsa-miR-106b-5p Inhibitor UAAAGUGCUGACAGUGCAGAU 5 nmol $170 Buy Now
MIM0134 hsa-miR-107 Mimic AGCAGCAUUGUACAGGGCUAUCA 5 nmol $170 Buy Now
INH0134 hsa-miR-107 Inhibitor AGCAGCAUUGUACAGGGCUAUCA 5 nmol $170 Buy Now
MIM0135 hsa-miR-122-3p Mimic AACGCCAUUAUCACACUAAAUA 5 nmol $170 Buy Now
INH0135 hsa-miR-122-3p Inhibitor AACGCCAUUAUCACACUAAAUA 5 nmol $170 Buy Now
MIM0136 hsa-miR-122-5p Mimic UGGAGUGUGACAAUGGUGUUUG 5 nmol $170 Buy Now
INH0136 hsa-miR-122-5p Inhibitor UGGAGUGUGACAAUGGUGUUUG 5 nmol $170 Buy Now
MIM0138 hsa-miR-124-3p Mimic UAAGGCACGCGGUGAAUGCC 5 nmol $170 Buy Now
INH0138 hsa-miR-124-3p Inhibitor UAAGGCACGCGGUGAAUGCC 5 nmol $170 Buy Now
MIM0137 hsa-miR-124-5p Mimic CGUGUUCACAGCGGACCUUGAU 5 nmol $170 Buy Now
INH0137 hsa-miR-124-5p Inhibitor CGUGUUCACAGCGGACCUUGAU 5 nmol $170 Buy Now
MIM0139 hsa-miR-125a-3p Mimic ACAGGUGAGGUUCUUGGGAGCC 5 nmol $170 Buy Now
INH0139 hsa-miR-125a-3p Inhibitor ACAGGUGAGGUUCUUGGGAGCC 5 nmol $170 Buy Now
MIM0143 hsa-miR-125a-5p Mimic UCCCUGAGACCCUUUAACCUGUGA 5 nmol $170 Buy Now
INH0143 hsa-miR-125a-5p Inhibitor UCCCUGAGACCCUUUAACCUGUGA 5 nmol $170 Buy Now
MIM0140 hsa-miR-125b-1-3p Mimic ACGGGUUAGGCUCUUGGGAGCU 5 nmol $170 Buy Now
INH0140 hsa-miR-125b-1-3p Inhibitor ACGGGUUAGGCUCUUGGGAGCU 5 nmol $170 Buy Now
MIM0141 hsa-miR-125b-2-3p Mimic UCACAAGUCAGGCUCUUGGGAC 5 nmol $170 Buy Now
INH0141 hsa-miR-125b-2-3p Inhibitor UCACAAGUCAGGCUCUUGGGAC 5 nmol $170 Buy Now
MIM0142 hsa-miR-125b-5p Mimic UCCCUGAGACCCUAACUUGUGA 5 nmol $170 Buy Now
INH0142 hsa-miR-125b-5p Inhibitor UCCCUGAGACCCUAACUUGUGA 5 nmol $170 Buy Now
MIM0145 hsa-miR-126-3p Mimic UCGUACCGUGAGUAAUAAUGCG 5 nmol $170 Buy Now
INH0145 hsa-miR-126-3p Inhibitor UCGUACCGUGAGUAAUAAUGCG 5 nmol $170 Buy Now
MIM0144 hsa-miR-126-5p Mimic CAUUAUUACUUUUGGUACGCG 5 nmol $170 Buy Now
INH0144 hsa-miR-126-5p Inhibitor CAUUAUUACUUUUGGUACGCG 5 nmol $170 Buy Now
MIM0147 hsa-miR-127-3p Mimic UCGGAUCCGUCUGAGCUUGGCU 5 nmol $170 Buy Now
INH0147 hsa-miR-127-3p Inhibitor UCGGAUCCGUCUGAGCUUGGCU 5 nmol $170 Buy Now
MIM0146 hsa-miR-127-5p Mimic CUGAAGCUCAGAGGGCUCUGAU 5 nmol $170 Buy Now
INH0146 hsa-miR-127-5p Inhibitor CUGAAGCUCAGAGGGCUCUGAU 5 nmol $170 Buy Now
MIM0148 hsa-miR-128 Mimic UCACAGUGAACCGGUCUCUUU 5 nmol $170 Buy Now
INH0148 hsa-miR-128 Inhibitor UCACAGUGAACCGGUCUCUUU 5 nmol $170 Buy Now
MIM0150 hsa-miR-129-1-3p Mimic AAGCCCUUACCCCAAAAAGUAU 5 nmol $170 Buy Now
INH0150 hsa-miR-129-1-3p Inhibitor AAGCCCUUACCCCAAAAAGUAU 5 nmol $170 Buy Now
MIM0149 hsa-miR-129-2-3p Mimic AAGCCCUUACCCCAAAAAGCAU 5 nmol $170 Buy Now
INH0149 hsa-miR-129-2-3p Inhibitor AAGCCCUUACCCCAAAAAGCAU 5 nmol $170 Buy Now
MIM0151 hsa-miR-129-5p Mimic CUUUUUGCGGUCUGGGCUUGC 5 nmol $170 Buy Now
INH0151 hsa-miR-129-5p Inhibitor CUUUUUGCGGUCUGGGCUUGC 5 nmol $170 Buy Now
MIM0154 hsa-miR-130a-3p Mimic CAGUGCAAUGUUAAAAGGGCAU 5 nmol $170 Buy Now
INH0154 hsa-miR-130a-3p Inhibitor CAGUGCAAUGUUAAAAGGGCAU 5 nmol $170 Buy Now
MIM0155 hsa-miR-130a-5p Mimic UUCACAUUGUGCUACUGUCUGC 5 nmol $170 Buy Now
INH0155 hsa-miR-130a-5p Inhibitor UUCACAUUGUGCUACUGUCUGC 5 nmol $170 Buy Now
MIM0153 hsa-miR-130b-3p Mimic CAGUGCAAUGAUGAAAGGGCAU 5 nmol $170 Buy Now
INH0153 hsa-miR-130b-3p Inhibitor CAGUGCAAUGAUGAAAGGGCAU 5 nmol $170 Buy Now
MIM0152 hsa-miR-130b-5p Mimic ACUCUUUCCCUGUUGCACUAC 5 nmol $170 Buy Now
INH0152 hsa-miR-130b-5p Inhibitor ACUCUUUCCCUGUUGCACUAC 5 nmol $170 Buy Now
MIM0157 hsa-miR-132-3p Mimic UAACAGUCUACAGCCAUGGUCG 5 nmol $170 Buy Now
INH0157 hsa-miR-132-3p Inhibitor UAACAGUCUACAGCCAUGGUCG 5 nmol $170 Buy Now
MIM0156 hsa-miR-132-5p Mimic ACCGUGGCUUUCGAUUGUUACU 5 nmol $170 Buy Now
INH0156 hsa-miR-132-5p Inhibitor ACCGUGGCUUUCGAUUGUUACU 5 nmol $170 Buy Now
MIM0863 hsa-miR-133a-3p Mimic UUUGGUCCCCUUCAACCAGCUG 5 nmol $170 Buy Now
INH0863 hsa-miR-133a-3p Inhibitor UUUGGUCCCCUUCAACCAGCUG 5 nmol $170 Buy Now
MIM0864 hsa-miR-133a-5p Mimic AGCUGGUAAAAUGGAACCAAAU 5 nmol $170 Buy Now
INH0864 hsa-miR-133a-5p Inhibitor AGCUGGUAAAAUGGAACCAAAU 5 nmol $170 Buy Now
MIM0158 hsa-miR-134 Mimic UGUGACUGGUUGACCAGAGGGG 5 nmol $170 Buy Now
INH0158 hsa-miR-134 Inhibitor UGUGACUGGUUGACCAGAGGGG 5 nmol $170 Buy Now
MIM0160 hsa-miR-135a-3p Mimic UAUAGGGAUUGGAGCCGUGGCG 5 nmol $170 Buy Now
INH0160 hsa-miR-135a-3p Inhibitor UAUAGGGAUUGGAGCCGUGGCG 5 nmol $170 Buy Now
MIM0162 hsa-miR-135a-5p Mimic UAUGGCUUUUUAUUCCUAUGUGA 5 nmol $170 Buy Now
INH0162 hsa-miR-135a-5p Inhibitor UAUGGCUUUUUAUUCCUAUGUGA 5 nmol $170 Buy Now
MIM0159 hsa-miR-135b-3p Mimic AUGUAGGGCUAAAAGCCAUGGG 5 nmol $170 Buy Now
INH0159 hsa-miR-135b-3p Inhibitor AUGUAGGGCUAAAAGCCAUGGG 5 nmol $170 Buy Now
MIM0161 hsa-miR-135b-5p Mimic UAUGGCUUUUCAUUCCUAUGUGA 5 nmol $170 Buy Now
INH0161 hsa-miR-135b-5p Inhibitor UAUGGCUUUUCAUUCCUAUGUGA 5 nmol $170 Buy Now
MIM0164 hsa-miR-136-3p Mimic CAUCAUCGUCUCAAAUGAGUCU 5 nmol $170 Buy Now
INH0164 hsa-miR-136-3p Inhibitor CAUCAUCGUCUCAAAUGAGUCU 5 nmol $170 Buy Now
MIM0163 hsa-miR-136-5p Mimic ACUCCAUUUGUUUUGAUGAUGGA 5 nmol $170 Buy Now
INH0163 hsa-miR-136-5p Inhibitor ACUCCAUUUGUUUUGAUGAUGGA 5 nmol $170 Buy Now
MIM0165 hsa-miR-137 Mimic UUAUUGCUUAAGAAUACGCGUAG 5 nmol $170 Buy Now
INH0165 hsa-miR-137 Inhibitor UUAUUGCUUAAGAAUACGCGUAG 5 nmol $170 Buy Now
MIM0167 hsa-miR-138-1-3p Mimic GCUACUUCACAACACCAGGGCC 5 nmol $170 Buy Now
INH0167 hsa-miR-138-1-3p Inhibitor GCUACUUCACAACACCAGGGCC 5 nmol $170 Buy Now
MIM0168 hsa-miR-138-2-3p Mimic GCUAUUUCACGACACCAGGGUU 5 nmol $170 Buy Now
INH0168 hsa-miR-138-2-3p Inhibitor GCUAUUUCACGACACCAGGGUU 5 nmol $170 Buy Now
MIM0166 hsa-miR-138-5p Mimic AGCUGGUGUUGUGAAUCAGGCCG 5 nmol $170 Buy Now
INH0166 hsa-miR-138-5p Inhibitor AGCUGGUGUUGUGAAUCAGGCCG 5 nmol $170 Buy Now
MIM0169 hsa-miR-139-3p Mimic GGAGACGCGGCCCUGUUGGAGU 5 nmol $170 Buy Now
INH0169 hsa-miR-139-3p Inhibitor GGAGACGCGGCCCUGUUGGAGU 5 nmol $170 Buy Now
MIM0170 hsa-miR-139-5p Mimic UCUACAGUGCACGUGUCUCCAG 5 nmol $170 Buy Now
INH0170 hsa-miR-139-5p Inhibitor UCUACAGUGCACGUGUCUCCAG 5 nmol $170 Buy Now
MIM0172 hsa-miR-140-3p Mimic UACCACAGGGUAGAACCACGG 5 nmol $170 Buy Now
INH0172 hsa-miR-140-3p Inhibitor UACCACAGGGUAGAACCACGG 5 nmol $170 Buy Now
MIM0171 hsa-miR-140-5p Mimic CAGUGGUUUUACCCUAUGGUAG 5 nmol $170 Buy Now
INH0171 hsa-miR-140-5p Inhibitor CAGUGGUUUUACCCUAUGGUAG 5 nmol $170 Buy Now
MIM0174 hsa-miR-141-3p Mimic UAACACUGUCUGGUAAAGAUGG 5 nmol $170 Buy Now
INH0174 hsa-miR-141-3p Inhibitor UAACACUGUCUGGUAAAGAUGG 5 nmol $170 Buy Now
MIM0173 hsa-miR-141-5p Mimic CAUCUUCCAGUACAGUGUUGGA 5 nmol $170 Buy Now
INH0173 hsa-miR-141-5p Inhibitor CAUCUUCCAGUACAGUGUUGGA 5 nmol $170 Buy Now
MIM0176 hsa-miR-142-3p Mimic UGUAGUGUUUCCUACUUUAUGGA 5 nmol $170 Buy Now
INH0176 hsa-miR-142-3p Inhibitor UGUAGUGUUUCCUACUUUAUGGA 5 nmol $170 Buy Now
MIM0175 hsa-miR-142-5p Mimic CAUAAAGUAGAAAGCACUACU 5 nmol $170 Buy Now
INH0175 hsa-miR-142-5p Inhibitor CAUAAAGUAGAAAGCACUACU 5 nmol $170 Buy Now
MIM0178 hsa-miR-143-3p Mimic UGAGAUGAAGCACUGUAGCUC 5 nmol $170 Buy Now
INH0178 hsa-miR-143-3p Inhibitor UGAGAUGAAGCACUGUAGCUC 5 nmol $170 Buy Now
MIM0177 hsa-miR-143-5p Mimic GGUGCAGUGCUGCAUCUCUGGU 5 nmol $170 Buy Now
INH0177 hsa-miR-143-5p Inhibitor GGUGCAGUGCUGCAUCUCUGGU 5 nmol $170 Buy Now
MIM0180 hsa-miR-144-3p Mimic UACAGUAUAGAUGAUGUACU 5 nmol $170 Buy Now
INH0180 hsa-miR-144-3p Inhibitor UACAGUAUAGAUGAUGUACU 5 nmol $170 Buy Now
MIM0179 hsa-miR-144-5p Mimic GGAUAUCAUCAUAUACUGUAAG 5 nmol $170 Buy Now
INH0179 hsa-miR-144-5p Inhibitor GGAUAUCAUCAUAUACUGUAAG 5 nmol $170 Buy Now
MIM0181 hsa-miR-145-3p Mimic GGAUUCCUGGAAAUACUGUUCU 5 nmol $170 Buy Now
INH0181 hsa-miR-145-3p Inhibitor GGAUUCCUGGAAAUACUGUUCU 5 nmol $170 Buy Now
MIM0182 hsa-miR-145-5p Mimic GUCCAGUUUUCCCAGGAAUCCCU 5 nmol $170 Buy Now
INH0182 hsa-miR-145-5p Inhibitor GUCCAGUUUUCCCAGGAAUCCCU 5 nmol $170 Buy Now
MIM0183 hsa-miR-146a-3p Mimic CCUCUGAAAUUCAGUUCUUCAG 5 nmol $170 Buy Now
INH0183 hsa-miR-146a-3p Inhibitor CCUCUGAAAUUCAGUUCUUCAG 5 nmol $170 Buy Now
MIM0185 hsa-miR-146a-5p Mimic UGAGAACUGAAUUCCAUGGGUU 5 nmol $170 Buy Now
INH0185 hsa-miR-146a-5p Inhibitor UGAGAACUGAAUUCCAUGGGUU 5 nmol $170 Buy Now
MIM0186 hsa-miR-146b-3p Mimic UGCCCUGUGGACUCAGUUCUGG 5 nmol $170 Buy Now
INH0186 hsa-miR-146b-3p Inhibitor UGCCCUGUGGACUCAGUUCUGG 5 nmol $170 Buy Now
MIM0184 hsa-miR-146b-5p Mimic UGAGAACUGAAUUCCAUAGGCU 5 nmol $170 Buy Now
INH0184 hsa-miR-146b-5p Inhibitor UGAGAACUGAAUUCCAUAGGCU 5 nmol $170 Buy Now
MIM0188 hsa-miR-147a Mimic GUGUGUGGAAAUGCUUCUGC 5 nmol $170 Buy Now
INH0188 hsa-miR-147a Inhibitor GUGUGUGGAAAUGCUUCUGC 5 nmol $170 Buy Now
MIM0187 hsa-miR-147b Mimic GUGUGCGGAAAUGCUUCUGCUA 5 nmol $170 Buy Now
INH0187 hsa-miR-147b Inhibitor GUGUGCGGAAAUGCUUCUGCUA 5 nmol $170 Buy Now
MIM0191 hsa-miR-148a-3p Mimic UCAGUGCACUACAGAACUUUGU 5 nmol $170 Buy Now
INH0191 hsa-miR-148a-3p Inhibitor UCAGUGCACUACAGAACUUUGU 5 nmol $170 Buy Now
MIM0189 hsa-miR-148a-5p Mimic AAAGUUCUGAGACACUCCGACU 5 nmol $170 Buy Now
INH0189 hsa-miR-148a-5p Inhibitor AAAGUUCUGAGACACUCCGACU 5 nmol $170 Buy Now
MIM0192 hsa-miR-148b-3p Mimic UCAGUGCAUCACAGAACUUUGU 5 nmol $170 Buy Now
INH0192 hsa-miR-148b-3p Inhibitor UCAGUGCAUCACAGAACUUUGU 5 nmol $170 Buy Now
MIM0190 hsa-miR-148b-5p Mimic AAGUUCUGUUAUACACUCAGGC 5 nmol $170 Buy Now
INH0190 hsa-miR-148b-5p Inhibitor AAGUUCUGUUAUACACUCAGGC 5 nmol $170 Buy Now
MIM0193 hsa-miR-149-3p Mimic AGGGAGGGACGGGGGCUGUGC 5 nmol $170 Buy Now
INH0193 hsa-miR-149-3p Inhibitor AGGGAGGGACGGGGGCUGUGC 5 nmol $170 Buy Now
MIM0194 hsa-miR-149-5p Mimic UCUGGCUCCGUGUCUUCACUCCC 5 nmol $170 Buy Now
INH0194 hsa-miR-149-5p Inhibitor UCUGGCUCCGUGUCUUCACUCCC 5 nmol $170 Buy Now
MIM0195 hsa-miR-150-3p Mimic CUGGUACAGGCCUGGGGGACAG 5 nmol $170 Buy Now
INH0195 hsa-miR-150-3p Inhibitor CUGGUACAGGCCUGGGGGACAG 5 nmol $170 Buy Now
MIM0196 hsa-miR-150-5p Mimic UCUCCCAACCCUUGUACCAGUG 5 nmol $170 Buy Now
INH0196 hsa-miR-150-5p Inhibitor UCUCCCAACCCUUGUACCAGUG 5 nmol $170 Buy Now
MIM0197 hsa-miR-151a-3p Mimic CUAGACUGAAGCUCCUUGAGG 5 nmol $170 Buy Now
INH0197 hsa-miR-151a-3p Inhibitor CUAGACUGAAGCUCCUUGAGG 5 nmol $170 Buy Now
MIM0198 hsa-miR-151a-5p Mimic UCGAGGAGCUCACAGUCUAGU 5 nmol $170 Buy Now
INH0198 hsa-miR-151a-5p Inhibitor UCGAGGAGCUCACAGUCUAGU 5 nmol $170 Buy Now
MIM0199 hsa-miR-152 Mimic UCAGUGCAUGACAGAACUUGG 5 nmol $170 Buy Now
INH0199 hsa-miR-152 Inhibitor UCAGUGCAUGACAGAACUUGG 5 nmol $170 Buy Now
MIM0200 hsa-miR-153 Mimic UUGCAUAGUCACAAAAGUGAUC 5 nmol $170 Buy Now
INH0200 hsa-miR-153 Inhibitor UUGCAUAGUCACAAAAGUGAUC 5 nmol $170 Buy Now
MIM0201 hsa-miR-154-3p Mimic AAUCAUACACGGUUGACCUAUU 5 nmol $170 Buy Now
INH0201 hsa-miR-154-3p Inhibitor AAUCAUACACGGUUGACCUAUU 5 nmol $170 Buy Now
MIM0202 hsa-miR-154-5p Mimic UAGGUUAUCCGUGUUGCCUUCG 5 nmol $170 Buy Now
INH0202 hsa-miR-154-5p Inhibitor UAGGUUAUCCGUGUUGCCUUCG 5 nmol $170 Buy Now
MIM0203 hsa-miR-155-3p Mimic CUCCUACAUAUUAGCAUUAACA 5 nmol $170 Buy Now
INH0203 hsa-miR-155-3p Inhibitor CUCCUACAUAUUAGCAUUAACA 5 nmol $170 Buy Now
MIM0204 hsa-miR-155-5p Mimic UUAAUGCUAAUCGUGAUAGGGGU 5 nmol $170 Buy Now
INH0204 hsa-miR-155-5p Inhibitor UUAAUGCUAAUCGUGAUAGGGGU 5 nmol $170 Buy Now
MIM0210 hsa-miR-181a-2-3p Mimic ACCACUGACCGUUGACUGUACC 5 nmol $170 Buy Now
INH0210 hsa-miR-181a-2-3p Inhibitor ACCACUGACCGUUGACUGUACC 5 nmol $170 Buy Now
MIM0211 hsa-miR-181a-3p Mimic ACCAUCGACCGUUGAUUGUACC 5 nmol $170 Buy Now
INH0211 hsa-miR-181a-3p Inhibitor ACCAUCGACCGUUGAUUGUACC 5 nmol $170 Buy Now
MIM0206 hsa-miR-181a-5p Mimic AACAUUCAACGCUGUCGGUGAGU 5 nmol $170 Buy Now
INH0206 hsa-miR-181a-5p Inhibitor AACAUUCAACGCUGUCGGUGAGU 5 nmol $170 Buy Now
MIM0207 hsa-miR-181b-5p Mimic AACAUUCAUUGCUGUCGGUGGGU 5 nmol $170 Buy Now
INH0207 hsa-miR-181b-5p Inhibitor AACAUUCAUUGCUGUCGGUGGGU 5 nmol $170 Buy Now
MIM0209 hsa-miR-181c-3p Mimic AACCAUCGACCGUUGAGUGGAC 5 nmol $170 Buy Now
INH0209 hsa-miR-181c-3p Inhibitor AACCAUCGACCGUUGAGUGGAC 5 nmol $170 Buy Now
MIM0205 hsa-miR-181c-5p Mimic AACAUUCAACCUGUCGGUGAGU 5 nmol $170 Buy Now
INH0205 hsa-miR-181c-5p Inhibitor AACAUUCAACCUGUCGGUGAGU 5 nmol $170 Buy Now
MIM0208 hsa-miR-181d Mimic AACAUUCAUUGUUGUCGGUGGGU 5 nmol $170 Buy Now
INH0208 hsa-miR-181d Inhibitor AACAUUCAUUGUUGUCGGUGGGU 5 nmol $170 Buy Now
MIM0212 hsa-miR-182-3p Mimic UGGUUCUAGACUUGCCAACUA 5 nmol $170 Buy Now
INH0212 hsa-miR-182-3p Inhibitor UGGUUCUAGACUUGCCAACUA 5 nmol $170 Buy Now
MIM0866 hsa-miR-182-5p Mimic UUUGGCAAUGGUAGAACUCACACU 5 nmol $170 Buy Now
INH0866 hsa-miR-182-5p Inhibitor UUUGGCAAUGGUAGAACUCACACU 5 nmol $170 Buy Now
MIM0213 hsa-miR-183-3p Mimic GUGAAUUACCGAAGGGCCAUAA 5 nmol $170 Buy Now
INH0213 hsa-miR-183-3p Inhibitor GUGAAUUACCGAAGGGCCAUAA 5 nmol $170 Buy Now
MIM0214 hsa-miR-183-5p Mimic UAUGGCACUGGUAGAAUUCACU 5 nmol $170 Buy Now
INH0214 hsa-miR-183-5p Inhibitor UAUGGCACUGGUAGAAUUCACU 5 nmol $170 Buy Now
MIM0215 hsa-miR-184 Mimic UGGACGGAGAACUGAUAAGGGU 5 nmol $170 Buy Now
INH0215 hsa-miR-184 Inhibitor UGGACGGAGAACUGAUAAGGGU 5 nmol $170 Buy Now
MIM0216 hsa-miR-185-3p Mimic AGGGGCUGGCUUUCCUCUGGUC 5 nmol $170 Buy Now
INH0216 hsa-miR-185-3p Inhibitor AGGGGCUGGCUUUCCUCUGGUC 5 nmol $170 Buy Now
MIM0217 hsa-miR-185-5p Mimic UGGAGAGAAAGGCAGUUCCUGA 5 nmol $170 Buy Now
INH0217 hsa-miR-185-5p Inhibitor UGGAGAGAAAGGCAGUUCCUGA 5 nmol $170 Buy Now
MIM0219 hsa-miR-186-3p Mimic GCCCAAAGGUGAAUUUUUUGGG 5 nmol $170 Buy Now
INH0219 hsa-miR-186-3p Inhibitor GCCCAAAGGUGAAUUUUUUGGG 5 nmol $170 Buy Now
MIM0218 hsa-miR-186-5p Mimic CAAAGAAUUCUCCUUUUGGGCU 5 nmol $170 Buy Now
INH0218 hsa-miR-186-5p Inhibitor CAAAGAAUUCUCCUUUUGGGCU 5 nmol $170 Buy Now
MIM0221 hsa-miR-187-3p Mimic UCGUGUCUUGUGUUGCAGCCGG 5 nmol $170 Buy Now
INH0221 hsa-miR-187-3p Inhibitor UCGUGUCUUGUGUUGCAGCCGG 5 nmol $170 Buy Now
MIM0220 hsa-miR-187-5p Mimic GGCUACAACACAGGACCCGGGC 5 nmol $170 Buy Now
INH0220 hsa-miR-187-5p Inhibitor GGCUACAACACAGGACCCGGGC 5 nmol $170 Buy Now
MIM0223 hsa-miR-188-3p Mimic CUCCCACAUGCAGGGUUUGCA 5 nmol $170 Buy Now
INH0223 hsa-miR-188-3p Inhibitor CUCCCACAUGCAGGGUUUGCA 5 nmol $170 Buy Now
MIM0222 hsa-miR-188-5p Mimic CAUCCCUUGCAUGGUGGAGGG 5 nmol $170 Buy Now
INH0222 hsa-miR-188-5p Inhibitor CAUCCCUUGCAUGGUGGAGGG 5 nmol $170 Buy Now
MIM0224 hsa-miR-190a Mimic UGAUAUGUUUGAUAUAUUAGGU 5 nmol $170 Buy Now
INH0224 hsa-miR-190a Inhibitor UGAUAUGUUUGAUAUAUUAGGU 5 nmol $170 Buy Now
MIM0225 hsa-miR-190b Mimic UGAUAUGUUUGAUAUUGGGUU 5 nmol $170 Buy Now
INH0225 hsa-miR-190b Inhibitor UGAUAUGUUUGAUAUUGGGUU 5 nmol $170 Buy Now
MIM0227 hsa-miR-191-3p Mimic GCUGCGCUUGGAUUUCGUCCCC 5 nmol $170 Buy Now
INH0227 hsa-miR-191-3p Inhibitor GCUGCGCUUGGAUUUCGUCCCC 5 nmol $170 Buy Now
MIM0226 hsa-miR-191-5p Mimic CAACGGAAUCCCAAAAGCAGCUG 5 nmol $170 Buy Now
INH0226 hsa-miR-191-5p Inhibitor CAACGGAAUCCCAAAAGCAGCUG 5 nmol $170 Buy Now
MIM0229 hsa-miR-192-3p Mimic CUGCCAAUUCCAUAGGUCACAG 5 nmol $170 Buy Now
INH0229 hsa-miR-192-3p Inhibitor CUGCCAAUUCCAUAGGUCACAG 5 nmol $170 Buy Now
MIM0228 hsa-miR-192-5p Mimic CUGACCUAUGAAUUGACAGCC 5 nmol $170 Buy Now
INH0228 hsa-miR-192-5p Inhibitor CUGACCUAUGAAUUGACAGCC 5 nmol $170 Buy Now
MIM0231 hsa-miR-193a-3p Mimic AACUGGCCUACAAAGUCCCAGU 5 nmol $170 Buy Now
INH0231 hsa-miR-193a-3p Inhibitor AACUGGCCUACAAAGUCCCAGU 5 nmol $170 Buy Now
MIM0233 hsa-miR-193a-5p Mimic UGGGUCUUUGCGGGCGAGAUGA 5 nmol $170 Buy Now
INH0233 hsa-miR-193a-5p Inhibitor UGGGUCUUUGCGGGCGAGAUGA 5 nmol $170 Buy Now
MIM0230 hsa-miR-193b-3p Mimic AACUGGCCCUCAAAGUCCCGCU 5 nmol $170 Buy Now
INH0230 hsa-miR-193b-3p Inhibitor AACUGGCCCUCAAAGUCCCGCU 5 nmol $170 Buy Now
MIM0232 hsa-miR-193b-5p Mimic CGGGGUUUUGAGGGCGAGAUGA 5 nmol $170 Buy Now
INH0232 hsa-miR-193b-5p Inhibitor CGGGGUUUUGAGGGCGAGAUGA 5 nmol $170 Buy Now
MIM0234 hsa-miR-194-3p Mimic CCAGUGGGGCUGCUGUUAUCUG 5 nmol $170 Buy Now
INH0234 hsa-miR-194-3p Inhibitor CCAGUGGGGCUGCUGUUAUCUG 5 nmol $170 Buy Now
MIM0235 hsa-miR-194-5p Mimic UGUAACAGCAACUCCAUGUGGA 5 nmol $170 Buy Now
INH0235 hsa-miR-194-5p Inhibitor UGUAACAGCAACUCCAUGUGGA 5 nmol $170 Buy Now
MIM0236 hsa-miR-195-3p Mimic CCAAUAUUGGCUGUGCUGCUCC 5 nmol $170 Buy Now
INH0236 hsa-miR-195-3p Inhibitor CCAAUAUUGGCUGUGCUGCUCC 5 nmol $170 Buy Now
MIM0237 hsa-miR-195-5p Mimic UAGCAGCACAGAAAUAUUGGC 5 nmol $170 Buy Now
INH0237 hsa-miR-195-5p Inhibitor UAGCAGCACAGAAAUAUUGGC 5 nmol $170 Buy Now
MIM0238 hsa-miR-196a-3p Mimic CGGCAACAAGAAACUGCCUGAG 5 nmol $170 Buy Now
INH0238 hsa-miR-196a-3p Inhibitor CGGCAACAAGAAACUGCCUGAG 5 nmol $170 Buy Now
MIM0239 hsa-miR-196a-5p Mimic UAGGUAGUUUCAUGUUGUUGGG 5 nmol $170 Buy Now
INH0239 hsa-miR-196a-5p Inhibitor UAGGUAGUUUCAUGUUGUUGGG 5 nmol $170 Buy Now
MIM0241 hsa-miR-196b-3p Mimic UCGACAGCACGACACUGCCUUC 5 nmol $170 Buy Now
INH0241 hsa-miR-196b-3p Inhibitor UCGACAGCACGACACUGCCUUC 5 nmol $170 Buy Now
MIM0240 hsa-miR-196b-5p Mimic UAGGUAGUUUCCUGUUGUUGGG 5 nmol $170 Buy Now
INH0240 hsa-miR-196b-5p Inhibitor UAGGUAGUUUCCUGUUGUUGGG 5 nmol $170 Buy Now
MIM0242 hsa-miR-197-3p Mimic UUCACCACCUUCUCCACCCAGC 5 nmol $170 Buy Now
INH0242 hsa-miR-197-3p Inhibitor UUCACCACCUUCUCCACCCAGC 5 nmol $170 Buy Now
MIM0243 hsa-miR-198 Mimic GGUCCAGAGGGGAGAUAGGUUC 5 nmol $170 Buy Now
INH0243 hsa-miR-198 Inhibitor GGUCCAGAGGGGAGAUAGGUUC 5 nmol $170 Buy Now
MIM0244 hsa-miR-199a-3p Mimic ACAGUAGUCUGCACAUUGGUUA 5 nmol $170 Buy Now
INH0244 hsa-miR-199a-3p Inhibitor ACAGUAGUCUGCACAUUGGUUA 5 nmol $170 Buy Now
MIM0245 hsa-miR-199a-5p Mimic CCCAGUGUUCAGACUACCUGUUC 5 nmol $170 Buy Now
INH0245 hsa-miR-199a-5p Inhibitor CCCAGUGUUCAGACUACCUGUUC 5 nmol $170 Buy Now
MIM0246 hsa-miR-199b-5p Mimic CCCAGUGUUUAGACUAUCUGUUC 5 nmol $170 Buy Now
INH0246 hsa-miR-199b-5p Inhibitor CCCAGUGUUUAGACUAUCUGUUC 5 nmol $170 Buy Now