Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

miR-400...miR-499

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price  
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
MIM0375 hsa-miR-409-3p Mimic GAAUGUUGCUCGGUGAACCCCU 5 nmol $170 Buy Now
INH0375 hsa-miR-409-3p Inhibitor GAAUGUUGCUCGGUGAACCCCU 5 nmol $170 Buy Now
MIM0374 hsa-miR-409-5p Mimic AGGUUACCCGAGCAACUUUGCAU 5 nmol $170 Buy Now
INH0374 hsa-miR-409-5p Inhibitor AGGUUACCCGAGCAACUUUGCAU 5 nmol $170 Buy Now
MIM0376 hsa-miR-410 Mimic AAUAUAACACAGAUGGCCUGU 5 nmol $170 Buy Now
INH0376 hsa-miR-410 Inhibitor AAUAUAACACAGAUGGCCUGU 5 nmol $170 Buy Now
MIM0378 hsa-miR-411-3p Mimic UAUGUAACACGGUCCACUAACC 5 nmol $170 Buy Now
INH0378 hsa-miR-411-3p Inhibitor UAUGUAACACGGUCCACUAACC 5 nmol $170 Buy Now
MIM0377 hsa-miR-411-5p Mimic UAGUAGACCGUAUAGCGUACG 5 nmol $170 Buy Now
INH0377 hsa-miR-411-5p Inhibitor UAGUAGACCGUAUAGCGUACG 5 nmol $170 Buy Now
MIM0379 hsa-miR-412 Mimic ACUUCACCUGGUCCACUAGCCGU 5 nmol $170 Buy Now
INH0379 hsa-miR-412 Inhibitor ACUUCACCUGGUCCACUAGCCGU 5 nmol $170 Buy Now
MIM0380 hsa-miR-421 Mimic AUCAACAGACAUUAAUUGGGCGC 5 nmol $170 Buy Now
INH0380 hsa-miR-421 Inhibitor AUCAACAGACAUUAAUUGGGCGC 5 nmol $170 Buy Now
MIM0381 hsa-miR-422a Mimic ACUGGACUUAGGGUCAGAAGGC 5 nmol $170 Buy Now
INH0381 hsa-miR-422a Inhibitor ACUGGACUUAGGGUCAGAAGGC 5 nmol $170 Buy Now
MIM0382 hsa-miR-423-3p Mimic AGCUCGGUCUGAGGCCCCUCAGU 5 nmol $170 Buy Now
INH0382 hsa-miR-423-3p Inhibitor AGCUCGGUCUGAGGCCCCUCAGU 5 nmol $170 Buy Now
MIM0383 hsa-miR-423-5p Mimic UGAGGGGCAGAGAGCGAGACUUU 5 nmol $170 Buy Now
INH0383 hsa-miR-423-5p Inhibitor UGAGGGGCAGAGAGCGAGACUUU 5 nmol $170 Buy Now
MIM0384 hsa-miR-424-3p Mimic CAAAACGUGAGGCGCUGCUAU 5 nmol $170 Buy Now
INH0384 hsa-miR-424-3p Inhibitor CAAAACGUGAGGCGCUGCUAU 5 nmol $170 Buy Now
MIM0385 hsa-miR-424-5p Mimic CAGCAGCAAUUCAUGUUUUGAA 5 nmol $170 Buy Now
INH0385 hsa-miR-424-5p Inhibitor CAGCAGCAAUUCAUGUUUUGAA 5 nmol $170 Buy Now
MIM0387 hsa-miR-425-3p Mimic AUCGGGAAUGUCGUGUCCGCCC 5 nmol $170 Buy Now
INH0387 hsa-miR-425-3p Inhibitor AUCGGGAAUGUCGUGUCCGCCC 5 nmol $170 Buy Now
MIM0386 hsa-miR-425-5p Mimic AAUGACACGAUCACUCCCGUUGA 5 nmol $170 Buy Now
INH0386 hsa-miR-425-5p Inhibitor AAUGACACGAUCACUCCCGUUGA 5 nmol $170 Buy Now
MIM0388 hsa-miR-429 Mimic UAAUACUGUCUGGUAAAACCGU 5 nmol $170 Buy Now
INH0388 hsa-miR-429 Inhibitor UAAUACUGUCUGGUAAAACCGU 5 nmol $170 Buy Now
MIM0389 hsa-miR-431-3p Mimic CAGGUCGUCUUGCAGGGCUUCU 5 nmol $170 Buy Now
INH0389 hsa-miR-431-3p Inhibitor CAGGUCGUCUUGCAGGGCUUCU 5 nmol $170 Buy Now
MIM0390 hsa-miR-431-5p Mimic UGUCUUGCAGGCCGUCAUGCA 5 nmol $170 Buy Now
INH0390 hsa-miR-431-5p Inhibitor UGUCUUGCAGGCCGUCAUGCA 5 nmol $170 Buy Now
MIM0391 hsa-miR-432-3p Mimic CUGGAUGGCUCCUCCAUGUCU 5 nmol $170 Buy Now
INH0391 hsa-miR-432-3p Inhibitor CUGGAUGGCUCCUCCAUGUCU 5 nmol $170 Buy Now
MIM0392 hsa-miR-432-5p Mimic UCUUGGAGUAGGUCAUUGGGUGG 5 nmol $170 Buy Now
INH0392 hsa-miR-432-5p Inhibitor UCUUGGAGUAGGUCAUUGGGUGG 5 nmol $170 Buy Now
MIM0393 hsa-miR-433 Mimic AUCAUGAUGGGCUCCUCGGUGU 5 nmol $170 Buy Now
INH0393 hsa-miR-433 Inhibitor AUCAUGAUGGGCUCCUCGGUGU 5 nmol $170 Buy Now
MIM0394 hsa-miR-448 Mimic UUGCAUAUGUAGGAUGUCCCAU 5 nmol $170 Buy Now
INH0394 hsa-miR-448 Inhibitor UUGCAUAUGUAGGAUGUCCCAU 5 nmol $170 Buy Now
MIM0397 hsa-miR-449a Mimic UGGCAGUGUAUUGUUAGCUGGU 5 nmol $170 Buy Now
INH0397 hsa-miR-449a Inhibitor UGGCAGUGUAUUGUUAGCUGGU 5 nmol $170 Buy Now
MIM0396 hsa-miR-449b-3p Mimic CAGCCACAACUACCCUGCCACU 5 nmol $170 Buy Now
INH0396 hsa-miR-449b-3p Inhibitor CAGCCACAACUACCCUGCCACU 5 nmol $170 Buy Now
MIM0395 hsa-miR-449b-5p Mimic AGGCAGUGUAUUGUUAGCUGGC 5 nmol $170 Buy Now
INH0395 hsa-miR-449b-5p Inhibitor AGGCAGUGUAUUGUUAGCUGGC 5 nmol $170 Buy Now
MIM0398 hsa-miR-450b-3p Mimic UUGGGAUCAUUUUGCAUCCAUA 5 nmol $170 Buy Now
INH0398 hsa-miR-450b-3p Inhibitor UUGGGAUCAUUUUGCAUCCAUA 5 nmol $170 Buy Now
MIM0399 hsa-miR-451a Mimic AAACCGUUACCAUUACUGAGUU 5 nmol $170 Buy Now
INH0399 hsa-miR-451a Inhibitor AAACCGUUACCAUUACUGAGUU 5 nmol $170 Buy Now
MIM0401 hsa-miR-452-3p Mimic CUCAUCUGCAAAGAAGUAAGUG 5 nmol $170 Buy Now
INH0401 hsa-miR-452-3p Inhibitor CUCAUCUGCAAAGAAGUAAGUG 5 nmol $170 Buy Now
MIM0400 hsa-miR-452-5p Mimic AACUGUUUGCAGAGGAAACUGA 5 nmol $170 Buy Now
INH0400 hsa-miR-452-5p Inhibitor AACUGUUUGCAGAGGAAACUGA 5 nmol $170 Buy Now
MIM0404 hsa-miR-454-3p Mimic UAGUGCAAUAUUGCUUAUAGGGU 5 nmol $170 Buy Now
INH0404 hsa-miR-454-3p Inhibitor UAGUGCAAUAUUGCUUAUAGGGU 5 nmol $170 Buy Now
MIM0403 hsa-miR-454-5p Mimic ACCCUAUCAAUAUUGUCUCUGC 5 nmol $170 Buy Now
INH0403 hsa-miR-454-5p Inhibitor ACCCUAUCAAUAUUGUCUCUGC 5 nmol $170 Buy Now
MIM0405 hsa-miR-455-3p Mimic GCAGUCCAUGGGCAUAUACAC 5 nmol $170 Buy Now
INH0405 hsa-miR-455-3p Inhibitor GCAGUCCAUGGGCAUAUACAC 5 nmol $170 Buy Now
MIM0406 hsa-miR-455-5p Mimic UAUGUGCCUUUGGACUACAUCG 5 nmol $170 Buy Now
INH0406 hsa-miR-455-5p Inhibitor UAUGUGCCUUUGGACUACAUCG 5 nmol $170 Buy Now
MIM0408 hsa-miR-483-3p Mimic UCACUCCUCUCCUCCCGUCUU 5 nmol $170 Buy Now
INH0408 hsa-miR-483-3p Inhibitor UCACUCCUCUCCUCCCGUCUU 5 nmol $170 Buy Now
MIM0407 hsa-miR-483-5p Mimic AAGACGGGAGGAAAGAAGGGAG 5 nmol $170 Buy Now
INH0407 hsa-miR-483-5p Inhibitor AAGACGGGAGGAAAGAAGGGAG 5 nmol $170 Buy Now
MIM0409 hsa-miR-484 Mimic UCAGGCUCAGUCCCCUCCCGAU 5 nmol $170 Buy Now
INH0409 hsa-miR-484 Inhibitor UCAGGCUCAGUCCCCUCCCGAU 5 nmol $170 Buy Now
MIM0411 hsa-miR-485-3p Mimic GUCAUACACGGCUCUCCUCUCU 5 nmol $170 Buy Now
INH0411 hsa-miR-485-3p Inhibitor GUCAUACACGGCUCUCCUCUCU 5 nmol $170 Buy Now
MIM0410 hsa-miR-485-5p Mimic AGAGGCUGGCCGUGAUGAAUUC 5 nmol $170 Buy Now
INH0410 hsa-miR-485-5p Inhibitor AGAGGCUGGCCGUGAUGAAUUC 5 nmol $170 Buy Now
MIM0412 hsa-miR-486-3p Mimic CGGGGCAGCUCAGUACAGGAU 5 nmol $170 Buy Now
INH0412 hsa-miR-486-3p Inhibitor CGGGGCAGCUCAGUACAGGAU 5 nmol $170 Buy Now
MIM0413 hsa-miR-486-5p Mimic UCCUGUACUGAGCUGCCCCGAG 5 nmol $170 Buy Now
INH0413 hsa-miR-486-5p Inhibitor UCCUGUACUGAGCUGCCCCGAG 5 nmol $170 Buy Now
MIM0414 hsa-miR-487a Mimic AAUCAUACAGGGACAUCCAGUU 5 nmol $170 Buy Now
INH0414 hsa-miR-487a Inhibitor AAUCAUACAGGGACAUCCAGUU 5 nmol $170 Buy Now
MIM0415 hsa-miR-487b Mimic AAUCGUACAGGGUCAUCCACUU 5 nmol $170 Buy Now
INH0415 hsa-miR-487b Inhibitor AAUCGUACAGGGUCAUCCACUU 5 nmol $170 Buy Now
MIM0417 hsa-miR-488-3p Mimic UUGAAAGGCUAUUUCUUGGUC 5 nmol $170 Buy Now
INH0417 hsa-miR-488-3p Inhibitor UUGAAAGGCUAUUUCUUGGUC 5 nmol $170 Buy Now
MIM0416 hsa-miR-488-5p Mimic CCCAGAUAAUGGCACUCUCAA 5 nmol $170 Buy Now
INH0416 hsa-miR-488-5p Inhibitor CCCAGAUAAUGGCACUCUCAA 5 nmol $170 Buy Now
MIM0418 hsa-miR-489 Mimic GUGACAUCACAUAUACGGCAGC 5 nmol $170 Buy Now
INH0418 hsa-miR-489 Inhibitor GUGACAUCACAUAUACGGCAGC 5 nmol $170 Buy Now
MIM0419 hsa-miR-490-3p Mimic CAACCUGGAGGACUCCAUGCUG 5 nmol $170 Buy Now
INH0419 hsa-miR-490-3p Inhibitor CAACCUGGAGGACUCCAUGCUG 5 nmol $170 Buy Now
MIM0420 hsa-miR-490-5p Mimic CCAUGGAUCUCCAGGUGGGU 5 nmol $170 Buy Now
INH0420 hsa-miR-490-5p Inhibitor CCAUGGAUCUCCAGGUGGGU 5 nmol $170 Buy Now
MIM0422 hsa-miR-491-3p Mimic CUUAUGCAAGAUUCCCUUCUAC 5 nmol $170 Buy Now
INH0422 hsa-miR-491-3p Inhibitor CUUAUGCAAGAUUCCCUUCUAC 5 nmol $170 Buy Now
MIM0421 hsa-miR-491-5p Mimic AGUGGGGAACCCUUCCAUGAGG 5 nmol $170 Buy Now
INH0421 hsa-miR-491-5p Inhibitor AGUGGGGAACCCUUCCAUGAGG 5 nmol $170 Buy Now
MIM0423 hsa-miR-492 Mimic AGGACCUGCGGGACAAGAUUCUU 5 nmol $170 Buy Now
INH0423 hsa-miR-492 Inhibitor AGGACCUGCGGGACAAGAUUCUU 5 nmol $170 Buy Now
MIM0424 hsa-miR-493-3p Mimic UGAAGGUCUACUGUGUGCCAGG 5 nmol $170 Buy Now
INH0424 hsa-miR-493-3p Inhibitor UGAAGGUCUACUGUGUGCCAGG 5 nmol $170 Buy Now
MIM0425 hsa-miR-493-5p Mimic UUGUACAUGGUAGGCUUUCAUU 5 nmol $170 Buy Now
INH0425 hsa-miR-493-5p Inhibitor UUGUACAUGGUAGGCUUUCAUU 5 nmol $170 Buy Now
MIM0426 hsa-miR-494 Mimic UGAAACAUACACGGGAAACCUC 5 nmol $170 Buy Now
INH0426 hsa-miR-494 Inhibitor UGAAACAUACACGGGAAACCUC 5 nmol $170 Buy Now
MIM0427 hsa-miR-495 Mimic AAACAAACAUGGUGCACUUCUU 5 nmol $170 Buy Now
INH0427 hsa-miR-495 Inhibitor AAACAAACAUGGUGCACUUCUU 5 nmol $170 Buy Now
MIM0428 hsa-miR-496 Mimic UGAGUAUUACAUGGCCAAUCUC 5 nmol $170 Buy Now
INH0428 hsa-miR-496 Inhibitor UGAGUAUUACAUGGCCAAUCUC 5 nmol $170 Buy Now
MIM0429 hsa-miR-497-3p Mimic CAAACCACACUGUGGUGUUAGA 5 nmol $170 Buy Now
INH0429 hsa-miR-497-3p Inhibitor CAAACCACACUGUGGUGUUAGA 5 nmol $170 Buy Now
MIM0430 hsa-miR-497-5p Mimic CAGCAGCACACUGUGGUUUGU 5 nmol $170 Buy Now
INH0430 hsa-miR-497-5p Inhibitor CAGCAGCACACUGUGGUUUGU 5 nmol $170 Buy Now
MIM0431 hsa-miR-498 Mimic UUUCAAGCCAGGGGGCGUUUUUC 5 nmol $170 Buy Now
INH0431 hsa-miR-498 Inhibitor UUUCAAGCCAGGGGGCGUUUUUC 5 nmol $170 Buy Now
MIM0432 hsa-miR-499a-3p Mimic AACAUCACAGCAAGUCUGUGCU 5 nmol $170 Buy Now
INH0432 hsa-miR-499a-3p Inhibitor AACAUCACAGCAAGUCUGUGCU 5 nmol $170 Buy Now
MIM0433 hsa-miR-499a-5p Mimic UUAAGACUUGCAGUGAUGUUU 5 nmol $170 Buy Now
INH0433 hsa-miR-499a-5p Inhibitor UUAAGACUUGCAGUGAUGUUU 5 nmol $170 Buy Now