Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items

miR-500...miR-599

study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

 
Product ID Name Sequence Format Price  
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
MIM0437 hsa-miR-501-3p Mimic AAUGCACCCGGGCAAGGAUUCU 5 nmol $170 Buy Now
INH0437 hsa-miR-501-3p Inhibitor AAUGCACCCGGGCAAGGAUUCU 5 nmol $170 Buy Now
MIM0436 hsa-miR-501-5p Mimic AAUCCUUUGUCCCUGGGUGAGA 5 nmol $170 Buy Now
INH0436 hsa-miR-501-5p Inhibitor AAUCCUUUGUCCCUGGGUGAGA 5 nmol $170 Buy Now
MIM0438 hsa-miR-502-3p Mimic AAUGCACCUGGGCAAGGAUUCA 5 nmol $170 Buy Now
INH0438 hsa-miR-502-3p Inhibitor AAUGCACCUGGGCAAGGAUUCA 5 nmol $170 Buy Now
MIM0439 hsa-miR-502-5p Mimic AUCCUUGCUAUCUGGGUGCUA 5 nmol $170 Buy Now
INH0439 hsa-miR-502-5p Inhibitor AUCCUUGCUAUCUGGGUGCUA 5 nmol $170 Buy Now
MIM0440 hsa-miR-503 Mimic UAGCAGCGGGAACAGUUCUGCAG 5 nmol $170 Buy Now
INH0440 hsa-miR-503 Inhibitor UAGCAGCGGGAACAGUUCUGCAG 5 nmol $170 Buy Now
MIM0441 hsa-miR-504 Mimic AGACCCUGGUCUGCACUCUAUC 5 nmol $170 Buy Now
INH0441 hsa-miR-504 Inhibitor AGACCCUGGUCUGCACUCUAUC 5 nmol $170 Buy Now
MIM0442 hsa-miR-505-3p Mimic CGUCAACACUUGCUGGUUUCCU 5 nmol $170 Buy Now
INH0442 hsa-miR-505-3p Inhibitor CGUCAACACUUGCUGGUUUCCU 5 nmol $170 Buy Now
MIM0443 hsa-miR-505-5p Mimic GGGAGCCAGGAAGUAUUGAUGU 5 nmol $170 Buy Now
INH0443 hsa-miR-505-5p Inhibitor GGGAGCCAGGAAGUAUUGAUGU 5 nmol $170 Buy Now
MIM0444 hsa-miR-506-3p Mimic UAAGGCACCCUUCUGAGUAGA 5 nmol $170 Buy Now
INH0444 hsa-miR-506-3p Inhibitor UAAGGCACCCUUCUGAGUAGA 5 nmol $170 Buy Now
MIM0446 hsa-miR-508-3p Mimic UGAUUGUAGCCUUUUGGAGUAGA 5 nmol $170 Buy Now
INH0446 hsa-miR-508-3p Inhibitor UGAUUGUAGCCUUUUGGAGUAGA 5 nmol $170 Buy Now
MIM0445 hsa-miR-508-5p Mimic UACUCCAGAGGGCGUCACUCAUG 5 nmol $170 Buy Now
INH0445 hsa-miR-508-5p Inhibitor UACUCCAGAGGGCGUCACUCAUG 5 nmol $170 Buy Now
MIM0448 hsa-miR-509-3-5p Mimic UACUGCAGACGUGGCAAUCAUG 5 nmol $170 Buy Now
INH0448 hsa-miR-509-3-5p Inhibitor UACUGCAGACGUGGCAAUCAUG 5 nmol $170 Buy Now
MIM0449 hsa-miR-509-3p Mimic UGAUUGGUACGUCUGUGGGUAG 5 nmol $170 Buy Now
INH0449 hsa-miR-509-3p Inhibitor UGAUUGGUACGUCUGUGGGUAG 5 nmol $170 Buy Now
MIM0447 hsa-miR-509-5p Mimic UACUGCAGACAGUGGCAAUCA 5 nmol $170 Buy Now
INH0447 hsa-miR-509-5p Inhibitor UACUGCAGACAGUGGCAAUCA 5 nmol $170 Buy Now
MIM0450 hsa-miR-510 Mimic UACUCAGGAGAGUGGCAAUCAC 5 nmol $170 Buy Now
INH0450 hsa-miR-510 Inhibitor UACUCAGGAGAGUGGCAAUCAC 5 nmol $170 Buy Now
MIM0451 hsa-miR-511 Mimic GUGUCUUUUGCUCUGCAGUCA 5 nmol $170 Buy Now
INH0451 hsa-miR-511 Inhibitor GUGUCUUUUGCUCUGCAGUCA 5 nmol $170 Buy Now
MIM0452 hsa-miR-512-3p Mimic AAGUGCUGUCAUAGCUGAGGUC 5 nmol $170 Buy Now
INH0452 hsa-miR-512-3p Inhibitor AAGUGCUGUCAUAGCUGAGGUC 5 nmol $170 Buy Now
MIM0453 hsa-miR-512-5p Mimic CACUCAGCCUUGAGGGCACUUUC 5 nmol $170 Buy Now
INH0453 hsa-miR-512-5p Inhibitor CACUCAGCCUUGAGGGCACUUUC 5 nmol $170 Buy Now
MIM0454 hsa-miR-513a-3p Mimic UAAAUUUCACCUUUCUGAGAAGG 5 nmol $170 Buy Now
INH0454 hsa-miR-513a-3p Inhibitor UAAAUUUCACCUUUCUGAGAAGG 5 nmol $170 Buy Now
MIM0456 hsa-miR-513a-5p Mimic UUCACAGGGAGGUGUCAU 5 nmol $170 Buy Now
INH0456 hsa-miR-513a-5p Inhibitor UUCACAGGGAGGUGUCAU 5 nmol $170 Buy Now
MIM0455 hsa-miR-513b Mimic UUCACAAGGAGGUGUCAUUUAU 5 nmol $170 Buy Now
INH0455 hsa-miR-513b Inhibitor UUCACAAGGAGGUGUCAUUUAU 5 nmol $170 Buy Now
MIM0457 hsa-miR-513c-5p Mimic UUCUCAAGGAGGUGUCGUUUAU 5 nmol $170 Buy Now
INH0457 hsa-miR-513c-5p Inhibitor UUCUCAAGGAGGUGUCGUUUAU 5 nmol $170 Buy Now
MIM0458 hsa-miR-514a-3p Mimic AUUGACACUUCUGUGAGUAGA 5 nmol $170 Buy Now
INH0458 hsa-miR-514a-3p Inhibitor AUUGACACUUCUGUGAGUAGA 5 nmol $170 Buy Now
MIM0459 hsa-miR-515-3p Mimic GAGUGCCUUCUUUUGGAGCGUU 5 nmol $170 Buy Now
INH0459 hsa-miR-515-3p Inhibitor GAGUGCCUUCUUUUGGAGCGUU 5 nmol $170 Buy Now
MIM0460 hsa-miR-515-5p Mimic UUCUCCAAAAGAAAGCACUUUCUG 5 nmol $170 Buy Now
INH0460 hsa-miR-515-5p Inhibitor UUCUCCAAAAGAAAGCACUUUCUG 5 nmol $170 Buy Now
MIM0462 hsa-miR-516a-3p Mimic UGCUUCCUUUCAGAGGGU 5 nmol $170 Buy Now
INH0462 hsa-miR-516a-3p Inhibitor UGCUUCCUUUCAGAGGGU 5 nmol $170 Buy Now
MIM0463 hsa-miR-516a-5p Mimic UUCUCGAGGAAAGAAGCACUUUC 5 nmol $170 Buy Now
INH0463 hsa-miR-516a-5p Inhibitor UUCUCGAGGAAAGAAGCACUUUC 5 nmol $170 Buy Now
MIM0461 hsa-miR-516b-5p Mimic AUCUGGAGGUAAGAAGCACUUU 5 nmol $170 Buy Now
INH0461 hsa-miR-516b-5p Inhibitor AUCUGGAGGUAAGAAGCACUUU 5 nmol $170 Buy Now
MIM0466 hsa-miR-517-5p Mimic CCUCUAGAUGGAAGCACUGUCU 5 nmol $170 Buy Now
INH0466 hsa-miR-517-5p Inhibitor CCUCUAGAUGGAAGCACUGUCU 5 nmol $170 Buy Now
MIM0464 hsa-miR-517a-3p Mimic AUCGUGCAUCCCUUUAGAGUGU 5 nmol $170 Buy Now
INH0464 hsa-miR-517a-3p Inhibitor AUCGUGCAUCCCUUUAGAGUGU 5 nmol $170 Buy Now
MIM0467 hsa-miR-517b-3p Mimic AUCGUGCAUCCCUUUAGAGUGU 5 nmol $170 Buy Now
INH0467 hsa-miR-517b-3p Inhibitor AUCGUGCAUCCCUUUAGAGUGU 5 nmol $170 Buy Now
MIM0465 hsa-miR-517c-3p Mimic AUCGUGCAUCCUUUUAGAGUGU 5 nmol $170 Buy Now
INH0465 hsa-miR-517c-3p Inhibitor AUCGUGCAUCCUUUUAGAGUGU 5 nmol $170 Buy Now
MIM0476 hsa-miR-518a-3p Mimic GAAAGCGCUUCCCUUUGCUGGA 5 nmol $170 Buy Now
INH0476 hsa-miR-518a-3p Inhibitor GAAAGCGCUUCCCUUUGCUGGA 5 nmol $170 Buy Now
MIM0475 hsa-miR-518a-5p Mimic CUGCAAAGGGAAGCCCUUUC 5 nmol $170 Buy Now
INH0475 hsa-miR-518a-5p Inhibitor CUGCAAAGGGAAGCCCUUUC 5 nmol $170 Buy Now
MIM0469 hsa-miR-518b Mimic CAAAGCGCUCCCCUUUAGAGGU 5 nmol $170 Buy Now
INH0469 hsa-miR-518b Inhibitor CAAAGCGCUCCCCUUUAGAGGU 5 nmol $170 Buy Now
MIM0471 hsa-miR-518c-3p Mimic CAAAGCGCUUCUCUUUAGAGUGU 5 nmol $170 Buy Now
INH0471 hsa-miR-518c-3p Inhibitor CAAAGCGCUUCUCUUUAGAGUGU 5 nmol $170 Buy Now
MIM0478 hsa-miR-518c-5p Mimic UCUCUGGAGGGAAGCACUUUCUG 5 nmol $170 Buy Now
INH0478 hsa-miR-518c-5p Inhibitor UCUCUGGAGGGAAGCACUUUCUG 5 nmol $170 Buy Now
MIM0470 hsa-miR-518d-3p Mimic CAAAGCGCUUCCCUUUGGAGC 5 nmol $170 Buy Now
INH0470 hsa-miR-518d-3p Inhibitor CAAAGCGCUUCCCUUUGGAGC 5 nmol $170 Buy Now
MIM0473 hsa-miR-518d-5p Mimic CUCUAGAGGGAAGCACUUUCUG 5 nmol $170 Buy Now
INH0473 hsa-miR-518d-5p Inhibitor CUCUAGAGGGAAGCACUUUCUG 5 nmol $170 Buy Now
MIM0468 hsa-miR-518e-3p Mimic AAAGCGCUUCCCUUCAGAGUG 5 nmol $170 Buy Now
INH0468 hsa-miR-518e-3p Inhibitor AAAGCGCUUCCCUUCAGAGUG 5 nmol $170 Buy Now
MIM0474 hsa-miR-518e-5p Mimic CUCUAGAGGGAAGCGCUUUCUG 5 nmol $170 Buy Now
INH0474 hsa-miR-518e-5p Inhibitor CUCUAGAGGGAAGCGCUUUCUG 5 nmol $170 Buy Now
MIM0477 hsa-miR-518f-3p Mimic GAAAGCGCUUCUCUUUAGAGG 5 nmol $170 Buy Now
INH0477 hsa-miR-518f-3p Inhibitor GAAAGCGCUUCUCUUUAGAGG 5 nmol $170 Buy Now
MIM0472 hsa-miR-518f-5p Mimic CUCUAGAGGGAAGCACUUUCUC 5 nmol $170 Buy Now
INH0472 hsa-miR-518f-5p Inhibitor CUCUAGAGGGAAGCACUUUCUC 5 nmol $170 Buy Now
MIM0480 hsa-miR-519a-3p Mimic AAAGUGCAUCCUUUUAGAGUGU 5 nmol $170 Buy Now
INH0480 hsa-miR-519a-3p Inhibitor AAAGUGCAUCCUUUUAGAGUGU 5 nmol $170 Buy Now
MIM0479 hsa-miR-519b-3p Mimic AAAGUGCAUCCUUUUAGAGGUU 5 nmol $170 Buy Now
INH0479 hsa-miR-519b-3p Inhibitor AAAGUGCAUCCUUUUAGAGGUU 5 nmol $170 Buy Now
MIM0481 hsa-miR-519c-3p Mimic AAAGUGCAUCUUUUUAGAGGAU 5 nmol $170 Buy Now
INH0481 hsa-miR-519c-3p Inhibitor AAAGUGCAUCUUUUUAGAGGAU 5 nmol $170 Buy Now
MIM0483 hsa-miR-519d Mimic CAAAGUGCCUCCCUUUAGAGUG 5 nmol $170 Buy Now
INH0483 hsa-miR-519d Inhibitor CAAAGUGCCUCCCUUUAGAGUG 5 nmol $170 Buy Now
MIM0482 hsa-miR-519e-3p Mimic AAGUGCCUCCUUUUAGAGUGUU 5 nmol $170 Buy Now
INH0482 hsa-miR-519e-3p Inhibitor AAGUGCCUCCUUUUAGAGUGUU 5 nmol $170 Buy Now
MIM0484 hsa-miR-519e-5p Mimic UUCUCCAAAAGGGAGCACUUUC 5 nmol $170 Buy Now
INH0484 hsa-miR-519e-5p Inhibitor UUCUCCAAAAGGGAGCACUUUC 5 nmol $170 Buy Now
MIM0485 hsa-miR-520a-3p Mimic AAAGUGCUUCCCUUUGGACUGU 5 nmol $170 Buy Now
INH0485 hsa-miR-520a-3p Inhibitor AAAGUGCUUCCCUUUGGACUGU 5 nmol $170 Buy Now
MIM0494 hsa-miR-520a-5p Mimic CUCCAGAGGGAAGUACUUUCU 5 nmol $170 Buy Now
INH0494 hsa-miR-520a-5p Inhibitor CUCCAGAGGGAAGUACUUUCU 5 nmol $170 Buy Now
MIM0486 hsa-miR-520b Mimic AAAGUGCUUCCUUUUAGAGGG 5 nmol $170 Buy Now
INH0486 hsa-miR-520b Inhibitor AAAGUGCUUCCUUUUAGAGGG 5 nmol $170 Buy Now
MIM0487 hsa-miR-520c-3p Mimic AAAGUGCUUCCUUUUAGAGGGU 5 nmol $170 Buy Now
INH0487 hsa-miR-520c-3p Inhibitor AAAGUGCUUCCUUUUAGAGGGU 5 nmol $170 Buy Now
MIM0489 hsa-miR-520d-3p Mimic AAAGUGCUUCUCUUUGGUGGGU 5 nmol $170 Buy Now
INH0489 hsa-miR-520d-3p Inhibitor AAAGUGCUUCUCUUUGGUGGGU 5 nmol $170 Buy Now
MIM0493 hsa-miR-520d-5p Mimic CUACAAAGGGAAGCCCUUUC 5 nmol $170 Buy Now
INH0493 hsa-miR-520d-5p Inhibitor CUACAAAGGGAAGCCCUUUC 5 nmol $170 Buy Now
MIM0488 hsa-miR-520e Mimic AAAGUGCUUCCUUUUUGAGGG 5 nmol $170 Buy Now
INH0488 hsa-miR-520e Inhibitor AAAGUGCUUCCUUUUUGAGGG 5 nmol $170 Buy Now
MIM0490 hsa-miR-520f Mimic AAGUGCUUCCUUUUAGAGGGUU 5 nmol $170 Buy Now
INH0490 hsa-miR-520f Inhibitor AAGUGCUUCCUUUUAGAGGGUU 5 nmol $170 Buy Now
MIM0492 hsa-miR-520g Mimic ACAAAGUGCUUCCCUUUAGAGUGU 5 nmol $170 Buy Now
INH0492 hsa-miR-520g Inhibitor ACAAAGUGCUUCCCUUUAGAGUGU 5 nmol $170 Buy Now
MIM0491 hsa-miR-520h Mimic ACAAAGUGCUUCCCUUUAGAGU 5 nmol $170 Buy Now
INH0491 hsa-miR-520h Inhibitor ACAAAGUGCUUCCCUUUAGAGU 5 nmol $170 Buy Now
MIM0495 hsa-miR-521 Mimic AACGCACUUCCCUUUAGAGUGU 5 nmol $170 Buy Now
INH0495 hsa-miR-521 Inhibitor AACGCACUUCCCUUUAGAGUGU 5 nmol $170 Buy Now
MIM0496 hsa-miR-522-3p Mimic AAAAUGGUUCCCUUUAGAGUGU 5 nmol $170 Buy Now
INH0496 hsa-miR-522-3p Inhibitor AAAAUGGUUCCCUUUAGAGUGU 5 nmol $170 Buy Now
MIM0497 hsa-miR-523-3p Mimic GAACGCGCUUCCCUAUAGAGGGU 5 nmol $170 Buy Now
INH0497 hsa-miR-523-3p Inhibitor GAACGCGCUUCCCUAUAGAGGGU 5 nmol $170 Buy Now
MIM0499 hsa-miR-524-3p Mimic GAAGGCGCUUCCCUUUGGAGU 5 nmol $170 Buy Now
INH0499 hsa-miR-524-3p Inhibitor GAAGGCGCUUCCCUUUGGAGU 5 nmol $170 Buy Now
MIM0498 hsa-miR-524-5p Mimic CUACAAAGGGAAGCACUUUCUC 5 nmol $170 Buy Now
INH0498 hsa-miR-524-5p Inhibitor CUACAAAGGGAAGCACUUUCUC 5 nmol $170 Buy Now
MIM0501 hsa-miR-525-3p Mimic GAAGGCGCUUCCCUUUAGAGCG 5 nmol $170 Buy Now
INH0501 hsa-miR-525-3p Inhibitor GAAGGCGCUUCCCUUUAGAGCG 5 nmol $170 Buy Now
MIM0500 hsa-miR-525-5p Mimic CUCCAGAGGGAUGCACUUUCU 5 nmol $170 Buy Now
INH0500 hsa-miR-525-5p Inhibitor CUCCAGAGGGAUGCACUUUCU 5 nmol $170 Buy Now
MIM0503 hsa-miR-526b-3p Mimic GAAAGUGCUUCCUUUUAGAGGC 5 nmol $170 Buy Now
INH0503 hsa-miR-526b-3p Inhibitor GAAAGUGCUUCCUUUUAGAGGC 5 nmol $170 Buy Now
MIM0502 hsa-miR-526b-5p Mimic CUCUUGAGGGAAGCACUUUCUGU 5 nmol $170 Buy Now
INH0502 hsa-miR-526b-5p Inhibitor CUCUUGAGGGAAGCACUUUCUGU 5 nmol $170 Buy Now
MIM0505 hsa-miR-532-3p Mimic CCUCCCACACCCAAGGCUUGCA 5 nmol $170 Buy Now
INH0505 hsa-miR-532-3p Inhibitor CCUCCCACACCCAAGGCUUGCA 5 nmol $170 Buy Now
MIM0504 hsa-miR-532-5p Mimic CAUGCCUUGAGUGUAGGACCGU 5 nmol $170 Buy Now
INH0504 hsa-miR-532-5p Inhibitor CAUGCCUUGAGUGUAGGACCGU 5 nmol $170 Buy Now
MIM0506 hsa-miR-539-5p Mimic GGAGAAAUUAUCCUUGGUGUGU 5 nmol $170 Buy Now
INH0506 hsa-miR-539-5p Inhibitor GGAGAAAUUAUCCUUGGUGUGU 5 nmol $170 Buy Now
MIM0508 hsa-miR-541-3p Mimic UGGUGGGCACAGAAUCUGGACU 5 nmol $170 Buy Now
INH0508 hsa-miR-541-3p Inhibitor UGGUGGGCACAGAAUCUGGACU 5 nmol $170 Buy Now
MIM0507 hsa-miR-541-5p Mimic AAAGGAUUCUGCUGUCGGUCCCACU 5 nmol $170 Buy Now
INH0507 hsa-miR-541-5p Inhibitor AAAGGAUUCUGCUGUCGGUCCCACU 5 nmol $170 Buy Now
MIM0510 hsa-miR-542-3p Mimic UGUGACAGAUUGAUAACUGAAA 5 nmol $170 Buy Now
INH0510 hsa-miR-542-3p Inhibitor UGUGACAGAUUGAUAACUGAAA 5 nmol $170 Buy Now
MIM0509 hsa-miR-542-5p Mimic UCGGGGAUCAUCAUGUCACGAGA 5 nmol $170 Buy Now
INH0509 hsa-miR-542-5p Inhibitor UCGGGGAUCAUCAUGUCACGAGA 5 nmol $170 Buy Now
MIM0511 hsa-miR-543 Mimic AAACAUUCGCGGUGCACUUCUU 5 nmol $170 Buy Now
INH0511 hsa-miR-543 Inhibitor AAACAUUCGCGGUGCACUUCUU 5 nmol $170 Buy Now
MIM0512 hsa-miR-544a Mimic AUUCUGCAUUUUUAGCAAGUUC 5 nmol $170 Buy Now
INH0512 hsa-miR-544a Inhibitor AUUCUGCAUUUUUAGCAAGUUC 5 nmol $170 Buy Now
MIM0513 hsa-miR-545-3p Mimic UCAGCAAACAUUUAUUGUGUGC 5 nmol $170 Buy Now
INH0513 hsa-miR-545-3p Inhibitor UCAGCAAACAUUUAUUGUGUGC 5 nmol $170 Buy Now
MIM0514 hsa-miR-545-5p Mimic UCAGUAAAUGUUUAUUAGAUGA 5 nmol $170 Buy Now
INH0514 hsa-miR-545-5p Inhibitor UCAGUAAAUGUUUAUUAGAUGA 5 nmol $170 Buy Now
MIM0529 hsa-miR-548a-3p Mimic CAAAACUGGCAAUUACUUUUGC 5 nmol $170 Buy Now
INH0529 hsa-miR-548a-3p Inhibitor CAAAACUGGCAAUUACUUUUGC 5 nmol $170 Buy Now
MIM0519 hsa-miR-548a-5p Mimic AAAAGUAAUUGCGAGUUUUACC 5 nmol $170 Buy Now
INH0519 hsa-miR-548a-5p Inhibitor AAAAGUAAUUGCGAGUUUUACC 5 nmol $170 Buy Now
MIM0532 hsa-miR-548b-3p Mimic CAAGAACCUCAGUUGCUUUUGU 5 nmol $170 Buy Now
INH0532 hsa-miR-548b-3p Inhibitor CAAGAACCUCAGUUGCUUUUGU 5 nmol $170 Buy Now
MIM0523 hsa-miR-548b-5p Mimic AAAAGUAAUUGUGGUUUUGGCC 5 nmol $170 Buy Now
INH0523 hsa-miR-548b-5p Inhibitor AAAAGUAAUUGUGGUUUUGGCC 5 nmol $170 Buy Now
MIM0528 hsa-miR-548c-3p Mimic CAAAAAUCUCAAUUACUUUUGC 5 nmol $170 Buy Now
INH0528 hsa-miR-548c-3p Inhibitor CAAAAAUCUCAAUUACUUUUGC 5 nmol $170 Buy Now
MIM0522 hsa-miR-548c-5p Mimic AAAAGUAAUUGCGGUUUUUGCC 5 nmol $170 Buy Now
INH0522 hsa-miR-548c-5p Inhibitor AAAAGUAAUUGCGGUUUUUGCC 5 nmol $170 Buy Now
MIM0527 hsa-miR-548d-3p Mimic CAAAAACCACAGUUUCUUUUGC 5 nmol $170 Buy Now
INH0527 hsa-miR-548d-3p Inhibitor CAAAAACCACAGUUUCUUUUGC 5 nmol $170 Buy Now
MIM0524 hsa-miR-548d-5p Mimic AAAAGUAAUUGUGGUUUUUGCC 5 nmol $170 Buy Now
INH0524 hsa-miR-548d-5p Inhibitor AAAAGUAAUUGUGGUUUUUGCC 5 nmol $170 Buy Now
MIM0515 hsa-miR-548e Mimic AAAAACUGAGACUACUUUUGCA 5 nmol $170 Buy Now
INH0515 hsa-miR-548e Inhibitor AAAAACUGAGACUACUUUUGCA 5 nmol $170 Buy Now
MIM0516 hsa-miR-548f Mimic AAAAACUGUAAUUACUUUU 5 nmol $170 Buy Now
INH0516 hsa-miR-548f Inhibitor AAAAACUGUAAUUACUUUU 5 nmol $170 Buy Now
MIM0517 hsa-miR-548g-3p Mimic AAAACUGUAAUUACUUUUGUAC 5 nmol $170 Buy Now
INH0517 hsa-miR-548g-3p Inhibitor AAAACUGUAAUUACUUUUGUAC 5 nmol $170 Buy Now
MIM0518 hsa-miR-548h-5p Mimic AAAAGUAAUCGCGGUUUUUGUC 5 nmol $170 Buy Now
INH0518 hsa-miR-548h-5p Inhibitor AAAAGUAAUCGCGGUUUUUGUC 5 nmol $170 Buy Now
MIM0520 hsa-miR-548i Mimic AAAAGUAAUUGCGGAUUUUGCC 5 nmol $170 Buy Now
INH0520 hsa-miR-548i Inhibitor AAAAGUAAUUGCGGAUUUUGCC 5 nmol $170 Buy Now
MIM0521 hsa-miR-548j Mimic AAAAGUAAUUGCGGUCUUUGGU 5 nmol $170 Buy Now
INH0521 hsa-miR-548j Inhibitor AAAAGUAAUUGCGGUCUUUGGU 5 nmol $170 Buy Now
MIM0525 hsa-miR-548k Mimic AAAAGUACUUGCGGAUUUUGCU 5 nmol $170 Buy Now
INH0525 hsa-miR-548k Inhibitor AAAAGUACUUGCGGAUUUUGCU 5 nmol $170 Buy Now
MIM0526 hsa-miR-548l Mimic AAAAGUAUUUGCGGGUUUUGUC 5 nmol $170 Buy Now
INH0526 hsa-miR-548l Inhibitor AAAAGUAUUUGCGGGUUUUGUC 5 nmol $170 Buy Now
MIM0531 hsa-miR-548m Mimic CAAAGGUAUUUGUGGUUUUUG 5 nmol $170 Buy Now
INH0531 hsa-miR-548m Inhibitor CAAAGGUAUUUGUGGUUUUUG 5 nmol $170 Buy Now
MIM0530 hsa-miR-548n Mimic CAAAAGUAAUUGUGGAUUUUGU 5 nmol $170 Buy Now
INH0530 hsa-miR-548n Inhibitor CAAAAGUAAUUGUGGAUUUUGU 5 nmol $170 Buy Now
MIM0533 hsa-miR-548o-3p Mimic CCAAAACUGCAGUUACUUUUGC 5 nmol $170 Buy Now
INH0533 hsa-miR-548o-3p Inhibitor CCAAAACUGCAGUUACUUUUGC 5 nmol $170 Buy Now
MIM0534 hsa-miR-548p Mimic UAGCAAAAACUGCAGUUACUUU 5 nmol $170 Buy Now
INH0534 hsa-miR-548p Inhibitor UAGCAAAAACUGCAGUUACUUU 5 nmol $170 Buy Now
MIM0535 hsa-miR-549 Mimic UGACAACUAUGGAUGAGCUCU 5 nmol $170 Buy Now
INH0535 hsa-miR-549 Inhibitor UGACAACUAUGGAUGAGCUCU 5 nmol $170 Buy Now
MIM0539 hsa-miR-551a Mimic GCGACCCACUCUUGGUUUCCA 5 nmol $170 Buy Now
INH0539 hsa-miR-551a Inhibitor GCGACCCACUCUUGGUUUCCA 5 nmol $170 Buy Now
MIM0540 hsa-miR-551b-3p Mimic GCGACCCAUACUUGGUUUCAG 5 nmol $170 Buy Now
INH0540 hsa-miR-551b-3p Inhibitor GCGACCCAUACUUGGUUUCAG 5 nmol $170 Buy Now
MIM0538 hsa-miR-551b-5p Mimic GAAAUCAAGCGUGGGUGAGACC 5 nmol $170 Buy Now
INH0538 hsa-miR-551b-5p Inhibitor GAAAUCAAGCGUGGGUGAGACC 5 nmol $170 Buy Now
MIM0541 hsa-miR-552 Mimic AACAGGUGACUGGUUAGACAA 5 nmol $170 Buy Now
INH0541 hsa-miR-552 Inhibitor AACAGGUGACUGGUUAGACAA 5 nmol $170 Buy Now
MIM0542 hsa-miR-553 Mimic AAAACGGUGAGAUUUUGUUUU 5 nmol $170 Buy Now
INH0542 hsa-miR-553 Inhibitor AAAACGGUGAGAUUUUGUUUU 5 nmol $170 Buy Now
MIM0543 hsa-miR-554 Mimic GCUAGUCCUGACUCAGCCAGU 5 nmol $170 Buy Now
INH0543 hsa-miR-554 Inhibitor GCUAGUCCUGACUCAGCCAGU 5 nmol $170 Buy Now
MIM0544 hsa-miR-555 Mimic AGGGUAAGCUGAACCUCUGAU 5 nmol $170 Buy Now
INH0544 hsa-miR-555 Inhibitor AGGGUAAGCUGAACCUCUGAU 5 nmol $170 Buy Now
MIM0545 hsa-miR-556-3p Mimic AUAUUACCAUUAGCUCAUCUUU 5 nmol $170 Buy Now
INH0545 hsa-miR-556-3p Inhibitor AUAUUACCAUUAGCUCAUCUUU 5 nmol $170 Buy Now
MIM0546 hsa-miR-556-5p Mimic GAUGAGCUCAUUGUAAUAUGAG 5 nmol $170 Buy Now
INH0546 hsa-miR-556-5p Inhibitor GAUGAGCUCAUUGUAAUAUGAG 5 nmol $170 Buy Now
MIM0547 hsa-miR-557 Mimic GUUUGCACGGGUGGGCCUUGUCU 5 nmol $170 Buy Now
INH0547 hsa-miR-557 Inhibitor GUUUGCACGGGUGGGCCUUGUCU 5 nmol $170 Buy Now
MIM0548 hsa-miR-558 Mimic UGAGCUGCUGUACCAAAAU 5 nmol $170 Buy Now
INH0548 hsa-miR-558 Inhibitor UGAGCUGCUGUACCAAAAU 5 nmol $170 Buy Now
MIM0549 hsa-miR-559 Mimic UAAAGUAAAUAUGCACCAAAA 5 nmol $170 Buy Now
INH0549 hsa-miR-559 Inhibitor UAAAGUAAAUAUGCACCAAAA 5 nmol $170 Buy Now
MIM0550 hsa-miR-561-3p Mimic CAAAGUUUAAGAUCCUUGAAGU 5 nmol $170 Buy Now
INH0550 hsa-miR-561-3p Inhibitor CAAAGUUUAAGAUCCUUGAAGU 5 nmol $170 Buy Now
MIM0551 hsa-miR-562 Mimic AAAGUAGCUGUACCAUUUGC 5 nmol $170 Buy Now
INH0551 hsa-miR-562 Inhibitor AAAGUAGCUGUACCAUUUGC 5 nmol $170 Buy Now
MIM0552 hsa-miR-563 Mimic AGGUUGACAUACGUUUCCC 5 nmol $170 Buy Now
INH0552 hsa-miR-563 Inhibitor AGGUUGACAUACGUUUCCC 5 nmol $170 Buy Now
MIM0553 hsa-miR-564 Mimic AGGCACGGUGUCAGCAGGC 5 nmol $170 Buy Now
INH0553 hsa-miR-564 Inhibitor AGGCACGGUGUCAGCAGGC 5 nmol $170 Buy Now
MIM0554 hsa-miR-566 Mimic GGGCGCCUGUGAUCCCAAC 5 nmol $170 Buy Now
INH0554 hsa-miR-566 Inhibitor GGGCGCCUGUGAUCCCAAC 5 nmol $170 Buy Now
MIM0555 hsa-miR-567 Mimic AGUAUGUUCUUCCAGGACAGAAC 5 nmol $170 Buy Now
INH0555 hsa-miR-567 Inhibitor AGUAUGUUCUUCCAGGACAGAAC 5 nmol $170 Buy Now
MIM0556 hsa-miR-568 Mimic AUGUAUAAAUGUAUACACAC 5 nmol $170 Buy Now
INH0556 hsa-miR-568 Inhibitor AUGUAUAAAUGUAUACACAC 5 nmol $170 Buy Now
MIM0557 hsa-miR-569 Mimic AGUUAAUGAAUCCUGGAAAGU 5 nmol $170 Buy Now
INH0557 hsa-miR-569 Inhibitor AGUUAAUGAAUCCUGGAAAGU 5 nmol $170 Buy Now
MIM0558 hsa-miR-570-3p Mimic CGAAAACAGCAAUUACCUUUGC 5 nmol $170 Buy Now
INH0558 hsa-miR-570-3p Inhibitor CGAAAACAGCAAUUACCUUUGC 5 nmol $170 Buy Now
MIM0559 hsa-miR-571 Mimic UGAGUUGGCCAUCUGAGUGAG 5 nmol $170 Buy Now
INH0559 hsa-miR-571 Inhibitor UGAGUUGGCCAUCUGAGUGAG 5 nmol $170 Buy Now
MIM0560 hsa-miR-572 Mimic GUCCGCUCGGCGGUGGCCCA 5 nmol $170 Buy Now
INH0560 hsa-miR-572 Inhibitor GUCCGCUCGGCGGUGGCCCA 5 nmol $170 Buy Now
MIM0561 hsa-miR-573 Mimic CUGAAGUGAUGUGUAACUGAUCAG 5 nmol $170 Buy Now
INH0561 hsa-miR-573 Inhibitor CUGAAGUGAUGUGUAACUGAUCAG 5 nmol $170 Buy Now
MIM0562 hsa-miR-574-3p Mimic CACGCUCAUGCACACACCCACA 5 nmol $170 Buy Now
INH0562 hsa-miR-574-3p Inhibitor CACGCUCAUGCACACACCCACA 5 nmol $170 Buy Now
MIM0563 hsa-miR-574-5p Mimic UGAGUGUGUGUGUGUGAGUGUGU 5 nmol $170 Buy Now
INH0563 hsa-miR-574-5p Inhibitor UGAGUGUGUGUGUGUGAGUGUGU 5 nmol $170 Buy Now
MIM0564 hsa-miR-575 Mimic GAGCCAGUUGGACAGGAGC 5 nmol $170 Buy Now
INH0564 hsa-miR-575 Inhibitor GAGCCAGUUGGACAGGAGC 5 nmol $170 Buy Now
MIM0565 hsa-miR-576-3p Mimic AAGAUGUGGAAAAAUUGGAAUC 5 nmol $170 Buy Now
INH0565 hsa-miR-576-3p Inhibitor AAGAUGUGGAAAAAUUGGAAUC 5 nmol $170 Buy Now
MIM0566 hsa-miR-576-5p Mimic AUUCUAAUUUCUCCACGUCUUU 5 nmol $170 Buy Now
INH0566 hsa-miR-576-5p Inhibitor AUUCUAAUUUCUCCACGUCUUU 5 nmol $170 Buy Now
MIM0567 hsa-miR-577 Mimic UAGAUAAAAUAUUGGUACCUG 5 nmol $170 Buy Now
INH0567 hsa-miR-577 Inhibitor UAGAUAAAAUAUUGGUACCUG 5 nmol $170 Buy Now
MIM0568 hsa-miR-578 Mimic CUUCUUGUGCUCUAGGAUUGU 5 nmol $170 Buy Now
INH0568 hsa-miR-578 Inhibitor CUUCUUGUGCUCUAGGAUUGU 5 nmol $170 Buy Now
MIM0569 hsa-miR-579 Mimic UUCAUUUGGUAUAAACCGCGAUU 5 nmol $170 Buy Now
INH0569 hsa-miR-579 Inhibitor UUCAUUUGGUAUAAACCGCGAUU 5 nmol $170 Buy Now
MIM0570 hsa-miR-580 Mimic UUGAGAAUGAUGAAUCAUUAGG 5 nmol $170 Buy Now
INH0570 hsa-miR-580 Inhibitor UUGAGAAUGAUGAAUCAUUAGG 5 nmol $170 Buy Now
MIM0571 hsa-miR-581 Mimic UCUUGUGUUCUCUAGAUCAGU 5 nmol $170 Buy Now
INH0571 hsa-miR-581 Inhibitor UCUUGUGUUCUCUAGAUCAGU 5 nmol $170 Buy Now
MIM0572 hsa-miR-582-3p Mimic UAACUGGUUGAACAACUGAACC 5 nmol $170 Buy Now
INH0572 hsa-miR-582-3p Inhibitor UAACUGGUUGAACAACUGAACC 5 nmol $170 Buy Now
MIM0573 hsa-miR-582-5p Mimic UUACAGUUGUUCAACCAGUUACU 5 nmol $170 Buy Now
INH0573 hsa-miR-582-5p Inhibitor UUACAGUUGUUCAACCAGUUACU 5 nmol $170 Buy Now
MIM0574 hsa-miR-583 Mimic CAAAGAGGAAGGUCCCAUUAC 5 nmol $170 Buy Now
INH0574 hsa-miR-583 Inhibitor CAAAGAGGAAGGUCCCAUUAC 5 nmol $170 Buy Now
MIM0575 hsa-miR-584-5p Mimic UUAUGGUUUGCCUGGGACUGAG 5 nmol $170 Buy Now
INH0575 hsa-miR-584-5p Inhibitor UUAUGGUUUGCCUGGGACUGAG 5 nmol $170 Buy Now
MIM0576 hsa-miR-585 Mimic UGGGCGUAUCUGUAUGCUA 5 nmol $170 Buy Now
INH0576 hsa-miR-585 Inhibitor UGGGCGUAUCUGUAUGCUA 5 nmol $170 Buy Now
MIM0577 hsa-miR-586 Mimic UAUGCAUUGUAUUUUUAGGUCC 5 nmol $170 Buy Now
INH0577 hsa-miR-586 Inhibitor UAUGCAUUGUAUUUUUAGGUCC 5 nmol $170 Buy Now
MIM0578 hsa-miR-587 Mimic UUUCCAUAGGUGAUGAGUCAC 5 nmol $170 Buy Now
INH0578 hsa-miR-587 Inhibitor UUUCCAUAGGUGAUGAGUCAC 5 nmol $170 Buy Now
MIM0579 hsa-miR-588 Mimic UUGGCCACAAUGGGUUAGAAC 5 nmol $170 Buy Now
INH0579 hsa-miR-588 Inhibitor UUGGCCACAAUGGGUUAGAAC 5 nmol $170 Buy Now
MIM0580 hsa-miR-589-3p Mimic UCAGAACAAAUGCCGGUUCCCAGA 5 nmol $170 Buy Now
INH0580 hsa-miR-589-3p Inhibitor UCAGAACAAAUGCCGGUUCCCAGA 5 nmol $170 Buy Now
MIM0581 hsa-miR-589-5p Mimic UGAGAACCACGUCUGCUCUGAG 5 nmol $170 Buy Now
INH0581 hsa-miR-589-5p Inhibitor UGAGAACCACGUCUGCUCUGAG 5 nmol $170 Buy Now
MIM0583 hsa-miR-590-3p Mimic UAAUUUUAUGUAUAAGCUAGU 5 nmol $170 Buy Now
INH0583 hsa-miR-590-3p Inhibitor UAAUUUUAUGUAUAAGCUAGU 5 nmol $170 Buy Now
MIM0582 hsa-miR-590-5p Mimic GAGCUUAUUCAUAAAAGUGCAG 5 nmol $170 Buy Now
INH0582 hsa-miR-590-5p Inhibitor GAGCUUAUUCAUAAAAGUGCAG 5 nmol $170 Buy Now
MIM0584 hsa-miR-591 Mimic AGACCAUGGGUUCUCAUUGU 5 nmol $170 Buy Now
INH0584 hsa-miR-591 Inhibitor AGACCAUGGGUUCUCAUUGU 5 nmol $170 Buy Now
MIM0585 hsa-miR-592 Mimic UUGUGUCAAUAUGCGAUGAUGU 5 nmol $170 Buy Now
INH0585 hsa-miR-592 Inhibitor UUGUGUCAAUAUGCGAUGAUGU 5 nmol $170 Buy Now
MIM0587 hsa-miR-593-3p Mimic UGUCUCUGCUGGGGUUUCU 5 nmol $170 Buy Now
INH0587 hsa-miR-593-3p Inhibitor UGUCUCUGCUGGGGUUUCU 5 nmol $170 Buy Now
MIM0586 hsa-miR-593-5p Mimic AGGCACCAGCCAGGCAUUGCUCAGC 5 nmol $170 Buy Now
INH0586 hsa-miR-593-5p Inhibitor AGGCACCAGCCAGGCAUUGCUCAGC 5 nmol $170 Buy Now
MIM0588 hsa-miR-595 Mimic GAAGUGUGCCGUGGUGUGUCU 5 nmol $170 Buy Now
INH0588 hsa-miR-595 Inhibitor GAAGUGUGCCGUGGUGUGUCU 5 nmol $170 Buy Now
MIM0589 hsa-miR-596 Mimic AAGCCUGCCCGGCUCCUCGGG 5 nmol $170 Buy Now
INH0589 hsa-miR-596 Inhibitor AAGCCUGCCCGGCUCCUCGGG 5 nmol $170 Buy Now
MIM0590 hsa-miR-597 Mimic UGUGUCACUCGAUGACCACUGU 5 nmol $170 Buy Now
INH0590 hsa-miR-597 Inhibitor UGUGUCACUCGAUGACCACUGU 5 nmol $170 Buy Now
MIM0591 hsa-miR-598 Mimic UACGUCAUCGUUGUCAUCGUCA 5 nmol $170 Buy Now
INH0591 hsa-miR-598 Inhibitor UACGUCAUCGUUGUCAUCGUCA 5 nmol $170 Buy Now
MIM0592 hsa-miR-599 Mimic GUUGUGUCAGUUUAUCAAAC 5 nmol $170 Buy Now
INH0592 hsa-miR-599 Inhibitor GUUGUGUCAGUUUAUCAAAC 5 nmol $170 Buy Now