Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items


study how miRNA-3´UTR interactions impact gene regulation

LightSwitch™ miRNA Mimics are transfected into cells to study the effects of over-expression of a miRNA of interest. In contrast, LightSwitch miRNA Inhibitors are used to knock down the expression of endogenous human miRNAs in living cells.

The combination of our miRNA Mimics and Inhibitors with our 3´UTR and Synthetic miRNA Target Reporter constructs provides a fully integrated system for validating the 3´UTR targets of your miRNAs of interest. We also offer Custom miRNA Target Validation Services in which our scientists can validate the targets of your miRNAs of interest using our high-throughput, cell-based assay.

IMPORTANT:  Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)

Find miRNA Mimics & Inhibitors by clicking one of the groups below:

LightSwitch™ Synthetic miRNA Target Reporters are ideal for use with the miRNA Mimics below. Each optimized construct contains repeats of a known 3´UTR sequence, which increases miRNA binding as compared to the native, endogenous sequence.

Product ID Name Sequence Format Price  
MIM9001 Non-targeting miRNA Mimic v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
INH9001 Non-targeting miRNA Inhibitor v1 UCACAACCUCCUAGAAAGAGUAGA 5 nmol $170 Buy Now
MIM9002 Non-targeting miRNA Mimic v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
INH9002 Non-targeting miRNA Inhibitor v2 UUGUACUACACAAAAGUACUG 5 nmol $170 Buy Now
MIM0593 hsa-miR-600 Mimic ACUUACAGACAAGAGCCUUGCUC 5 nmol $170 Buy Now
INH0593 hsa-miR-600 Inhibitor ACUUACAGACAAGAGCCUUGCUC 5 nmol $170 Buy Now
MIM0594 hsa-miR-601 Mimic UGGUCUAGGAUUGUUGGAGGAG 5 nmol $170 Buy Now
INH0594 hsa-miR-601 Inhibitor UGGUCUAGGAUUGUUGGAGGAG 5 nmol $170 Buy Now
MIM0595 hsa-miR-602 Mimic GACACGGGCGACAGCUGCGGCCC 5 nmol $170 Buy Now
INH0595 hsa-miR-602 Inhibitor GACACGGGCGACAGCUGCGGCCC 5 nmol $170 Buy Now
MIM0596 hsa-miR-603 Mimic CACACACUGCAAUUACUUUUGC 5 nmol $170 Buy Now
INH0596 hsa-miR-603 Inhibitor CACACACUGCAAUUACUUUUGC 5 nmol $170 Buy Now
MIM0597 hsa-miR-604 Mimic AGGCUGCGGAAUUCAGGAC 5 nmol $170 Buy Now
INH0597 hsa-miR-604 Inhibitor AGGCUGCGGAAUUCAGGAC 5 nmol $170 Buy Now
MIM0598 hsa-miR-605 Mimic UAAAUCCCAUGGUGCCUUCUCCU 5 nmol $170 Buy Now
INH0598 hsa-miR-605 Inhibitor UAAAUCCCAUGGUGCCUUCUCCU 5 nmol $170 Buy Now
MIM0599 hsa-miR-606 Mimic AAACUACUGAAAAUCAAAGAU 5 nmol $170 Buy Now
INH0599 hsa-miR-606 Inhibitor AAACUACUGAAAAUCAAAGAU 5 nmol $170 Buy Now
MIM0600 hsa-miR-607 Mimic GUUCAAAUCCAGAUCUAUAAC 5 nmol $170 Buy Now
INH0600 hsa-miR-607 Inhibitor GUUCAAAUCCAGAUCUAUAAC 5 nmol $170 Buy Now
MIM0601 hsa-miR-608 Mimic AGGGGUGGUGUUGGGACAGCUCCGU 5 nmol $170 Buy Now
INH0601 hsa-miR-608 Inhibitor AGGGGUGGUGUUGGGACAGCUCCGU 5 nmol $170 Buy Now
MIM0602 hsa-miR-609 Mimic AGGGUGUUUCUCUCAUCUCU 5 nmol $170 Buy Now
INH0602 hsa-miR-609 Inhibitor AGGGUGUUUCUCUCAUCUCU 5 nmol $170 Buy Now
MIM0603 hsa-miR-610 Mimic UGAGCUAAAUGUGUGCUGGGA 5 nmol $170 Buy Now
INH0603 hsa-miR-610 Inhibitor UGAGCUAAAUGUGUGCUGGGA 5 nmol $170 Buy Now
MIM0604 hsa-miR-611 Mimic GCGAGGACCCCUCGGGGUCUGAC 5 nmol $170 Buy Now
INH0604 hsa-miR-611 Inhibitor GCGAGGACCCCUCGGGGUCUGAC 5 nmol $170 Buy Now
MIM0605 hsa-miR-612 Mimic GCUGGGCAGGGCUUCUGAGCUCCUU 5 nmol $170 Buy Now
INH0605 hsa-miR-612 Inhibitor GCUGGGCAGGGCUUCUGAGCUCCUU 5 nmol $170 Buy Now
MIM0606 hsa-miR-613 Mimic AGGAAUGUUCCUUCUUUGCC 5 nmol $170 Buy Now
INH0606 hsa-miR-613 Inhibitor AGGAAUGUUCCUUCUUUGCC 5 nmol $170 Buy Now
MIM0607 hsa-miR-614 Mimic GAACGCCUGUUCUUGCCAGGUGG 5 nmol $170 Buy Now
INH0607 hsa-miR-614 Inhibitor GAACGCCUGUUCUUGCCAGGUGG 5 nmol $170 Buy Now
MIM0609 hsa-miR-615-3p Mimic UCCGAGCCUGGGUCUCCCUCUU 5 nmol $170 Buy Now
INH0609 hsa-miR-615-3p Inhibitor UCCGAGCCUGGGUCUCCCUCUU 5 nmol $170 Buy Now
MIM0608 hsa-miR-615-5p Mimic GGGGGUCCCCGGUGCUCGGAUC 5 nmol $170 Buy Now
INH0608 hsa-miR-615-5p Inhibitor GGGGGUCCCCGGUGCUCGGAUC 5 nmol $170 Buy Now
MIM0611 hsa-miR-616-3p Mimic AGUCAUUGGAGGGUUUGAGCAG 5 nmol $170 Buy Now
INH0611 hsa-miR-616-3p Inhibitor AGUCAUUGGAGGGUUUGAGCAG 5 nmol $170 Buy Now
MIM0610 hsa-miR-616-5p Mimic ACUCAAAACCCUUCAGUGACUU 5 nmol $170 Buy Now
INH0610 hsa-miR-616-5p Inhibitor ACUCAAAACCCUUCAGUGACUU 5 nmol $170 Buy Now
MIM0612 hsa-miR-617 Mimic AGACUUCCCAUUUGAAGGUGGC 5 nmol $170 Buy Now
INH0612 hsa-miR-617 Inhibitor AGACUUCCCAUUUGAAGGUGGC 5 nmol $170 Buy Now
MIM0613 hsa-miR-618 Mimic AAACUCUACUUGUCCUUCUGAGU 5 nmol $170 Buy Now
INH0613 hsa-miR-618 Inhibitor AAACUCUACUUGUCCUUCUGAGU 5 nmol $170 Buy Now
MIM0614 hsa-miR-619 Mimic GACCUGGACAUGUUUGUGCCCAGU 5 nmol $170 Buy Now
INH0614 hsa-miR-619 Inhibitor GACCUGGACAUGUUUGUGCCCAGU 5 nmol $170 Buy Now
MIM0615 hsa-miR-620 Mimic AUGGAGAUAGAUAUAGAAAU 5 nmol $170 Buy Now
INH0615 hsa-miR-620 Inhibitor AUGGAGAUAGAUAUAGAAAU 5 nmol $170 Buy Now
MIM0616 hsa-miR-621 Mimic GGCUAGCAACAGCGCUUACCU 5 nmol $170 Buy Now
INH0616 hsa-miR-621 Inhibitor GGCUAGCAACAGCGCUUACCU 5 nmol $170 Buy Now
MIM0617 hsa-miR-622 Mimic ACAGUCUGCUGAGGUUGGAGC 5 nmol $170 Buy Now
INH0617 hsa-miR-622 Inhibitor ACAGUCUGCUGAGGUUGGAGC 5 nmol $170 Buy Now
MIM0618 hsa-miR-623 Mimic AUCCCUUGCAGGGGCUGUUGGGU 5 nmol $170 Buy Now
INH0618 hsa-miR-623 Inhibitor AUCCCUUGCAGGGGCUGUUGGGU 5 nmol $170 Buy Now
MIM0619 hsa-miR-624-3p Mimic CACAAGGUAUUGGUAUUACCU 5 nmol $170 Buy Now
INH0619 hsa-miR-624-3p Inhibitor CACAAGGUAUUGGUAUUACCU 5 nmol $170 Buy Now
MIM0620 hsa-miR-624-5p Mimic UAGUACCAGUACCUUGUGUUCA 5 nmol $170 Buy Now
INH0620 hsa-miR-624-5p Inhibitor UAGUACCAGUACCUUGUGUUCA 5 nmol $170 Buy Now
MIM0622 hsa-miR-625-3p Mimic GACUAUAGAACUUUCCCCCUCA 5 nmol $170 Buy Now
INH0622 hsa-miR-625-3p Inhibitor GACUAUAGAACUUUCCCCCUCA 5 nmol $170 Buy Now
MIM0621 hsa-miR-625-5p Mimic AGGGGGAAAGUUCUAUAGUCC 5 nmol $170 Buy Now
INH0621 hsa-miR-625-5p Inhibitor AGGGGGAAAGUUCUAUAGUCC 5 nmol $170 Buy Now
MIM0623 hsa-miR-626 Mimic AGCUGUCUGAAAAUGUCUU 5 nmol $170 Buy Now
INH0623 hsa-miR-626 Inhibitor AGCUGUCUGAAAAUGUCUU 5 nmol $170 Buy Now
MIM0624 hsa-miR-627 Mimic GUGAGUCUCUAAGAAAAGAGGA 5 nmol $170 Buy Now
INH0624 hsa-miR-627 Inhibitor GUGAGUCUCUAAGAAAAGAGGA 5 nmol $170 Buy Now
MIM0626 hsa-miR-628-3p Mimic UCUAGUAAGAGUGGCAGUCGA 5 nmol $170 Buy Now
INH0626 hsa-miR-628-3p Inhibitor UCUAGUAAGAGUGGCAGUCGA 5 nmol $170 Buy Now
MIM0625 hsa-miR-628-5p Mimic AUGCUGACAUAUUUACUAGAGG 5 nmol $170 Buy Now
INH0625 hsa-miR-628-5p Inhibitor AUGCUGACAUAUUUACUAGAGG 5 nmol $170 Buy Now
MIM0627 hsa-miR-629-3p Mimic GUUCUCCCAACGUAAGCCCAGC 5 nmol $170 Buy Now
INH0627 hsa-miR-629-3p Inhibitor GUUCUCCCAACGUAAGCCCAGC 5 nmol $170 Buy Now
MIM0628 hsa-miR-629-5p Mimic UGGGUUUACGUUGGGAGAACU 5 nmol $170 Buy Now
INH0628 hsa-miR-629-5p Inhibitor UGGGUUUACGUUGGGAGAACU 5 nmol $170 Buy Now
MIM0629 hsa-miR-630 Mimic AGUAUUCUGUACCAGGGAAGGU 5 nmol $170 Buy Now
INH0629 hsa-miR-630 Inhibitor AGUAUUCUGUACCAGGGAAGGU 5 nmol $170 Buy Now
MIM0630 hsa-miR-631 Mimic AGACCUGGCCCAGACCUCAGC 5 nmol $170 Buy Now
INH0630 hsa-miR-631 Inhibitor AGACCUGGCCCAGACCUCAGC 5 nmol $170 Buy Now
MIM0631 hsa-miR-632 Mimic GUGUCUGCUUCCUGUGGGA 5 nmol $170 Buy Now
INH0631 hsa-miR-632 Inhibitor GUGUCUGCUUCCUGUGGGA 5 nmol $170 Buy Now
MIM0632 hsa-miR-633 Mimic CUAAUAGUAUCUACCACAAUAAA 5 nmol $170 Buy Now
INH0632 hsa-miR-633 Inhibitor CUAAUAGUAUCUACCACAAUAAA 5 nmol $170 Buy Now
MIM0633 hsa-miR-634 Mimic AACCAGCACCCCAACUUUGGAC 5 nmol $170 Buy Now
INH0633 hsa-miR-634 Inhibitor AACCAGCACCCCAACUUUGGAC 5 nmol $170 Buy Now
MIM0634 hsa-miR-635 Mimic ACUUGGGCACUGAAACAAUGUCC 5 nmol $170 Buy Now
INH0634 hsa-miR-635 Inhibitor ACUUGGGCACUGAAACAAUGUCC 5 nmol $170 Buy Now
MIM0635 hsa-miR-636 Mimic UGUGCUUGCUCGUCCCGCCCGCA 5 nmol $170 Buy Now
INH0635 hsa-miR-636 Inhibitor UGUGCUUGCUCGUCCCGCCCGCA 5 nmol $170 Buy Now
MIM0636 hsa-miR-637 Mimic ACUGGGGGCUUUCGGGCUCUGCGU 5 nmol $170 Buy Now
INH0636 hsa-miR-637 Inhibitor ACUGGGGGCUUUCGGGCUCUGCGU 5 nmol $170 Buy Now
MIM0637 hsa-miR-638 Mimic AGGGAUCGCGGGCGGGUGGCGGCCU 5 nmol $170 Buy Now
INH0637 hsa-miR-638 Inhibitor AGGGAUCGCGGGCGGGUGGCGGCCU 5 nmol $170 Buy Now
MIM0638 hsa-miR-639 Mimic AUCGCUGCGGUUGCGAGCGCUGU 5 nmol $170 Buy Now
INH0638 hsa-miR-639 Inhibitor AUCGCUGCGGUUGCGAGCGCUGU 5 nmol $170 Buy Now
MIM0639 hsa-miR-640 Mimic AUGAUCCAGGAACCUGCCUCU 5 nmol $170 Buy Now
INH0639 hsa-miR-640 Inhibitor AUGAUCCAGGAACCUGCCUCU 5 nmol $170 Buy Now
MIM0640 hsa-miR-641 Mimic AAAGACAUAGGAUAGAGUCACCUC 5 nmol $170 Buy Now
INH0640 hsa-miR-641 Inhibitor AAAGACAUAGGAUAGAGUCACCUC 5 nmol $170 Buy Now
MIM0642 hsa-miR-643 Mimic ACUUGUAUGCUAGCUCAGGUAG 5 nmol $170 Buy Now
INH0642 hsa-miR-643 Inhibitor ACUUGUAUGCUAGCUCAGGUAG 5 nmol $170 Buy Now
MIM0643 hsa-miR-644a Mimic AGUGUGGCUUUCUUAGAGC 5 nmol $170 Buy Now
INH0643 hsa-miR-644a Inhibitor AGUGUGGCUUUCUUAGAGC 5 nmol $170 Buy Now
MIM0644 hsa-miR-645 Mimic UCUAGGCUGGUACUGCUGA 5 nmol $170 Buy Now
INH0644 hsa-miR-645 Inhibitor UCUAGGCUGGUACUGCUGA 5 nmol $170 Buy Now
MIM0645 hsa-miR-646 Mimic AAGCAGCUGCCUCUGAGGC 5 nmol $170 Buy Now
INH0645 hsa-miR-646 Inhibitor AAGCAGCUGCCUCUGAGGC 5 nmol $170 Buy Now
MIM0646 hsa-miR-647 Mimic GUGGCUGCACUCACUUCCUUC 5 nmol $170 Buy Now
INH0646 hsa-miR-647 Inhibitor GUGGCUGCACUCACUUCCUUC 5 nmol $170 Buy Now
MIM0647 hsa-miR-648 Mimic AAGUGUGCAGGGCACUGGU 5 nmol $170 Buy Now
INH0647 hsa-miR-648 Inhibitor AAGUGUGCAGGGCACUGGU 5 nmol $170 Buy Now
MIM0648 hsa-miR-649 Mimic AAACCUGUGUUGUUCAAGAGUC 5 nmol $170 Buy Now
INH0648 hsa-miR-649 Inhibitor AAACCUGUGUUGUUCAAGAGUC 5 nmol $170 Buy Now
MIM0649 hsa-miR-650 Mimic AGGAGGCAGCGCUCUCAGGAC 5 nmol $170 Buy Now
INH0649 hsa-miR-650 Inhibitor AGGAGGCAGCGCUCUCAGGAC 5 nmol $170 Buy Now
MIM0650 hsa-miR-651 Mimic UUUAGGAUAAGCUUGACUUUUG 5 nmol $170 Buy Now
INH0650 hsa-miR-651 Inhibitor UUUAGGAUAAGCUUGACUUUUG 5 nmol $170 Buy Now
MIM0651 hsa-miR-652-3p Mimic AAUGGCGCCACUAGGGUUGUG 5 nmol $170 Buy Now
INH0651 hsa-miR-652-3p Inhibitor AAUGGCGCCACUAGGGUUGUG 5 nmol $170 Buy Now
MIM0652 hsa-miR-653 Mimic GUGUUGAAACAAUCUCUACUG 5 nmol $170 Buy Now
INH0652 hsa-miR-653 Inhibitor GUGUUGAAACAAUCUCUACUG 5 nmol $170 Buy Now
MIM0653 hsa-miR-654-3p Mimic UAUGUCUGCUGACCAUCACCUU 5 nmol $170 Buy Now
INH0653 hsa-miR-654-3p Inhibitor UAUGUCUGCUGACCAUCACCUU 5 nmol $170 Buy Now
MIM0654 hsa-miR-654-5p Mimic UGGUGGGCCGCAGAACAUGUGC 5 nmol $170 Buy Now
INH0654 hsa-miR-654-5p Inhibitor UGGUGGGCCGCAGAACAUGUGC 5 nmol $170 Buy Now
MIM0655 hsa-miR-655 Mimic AUAAUACAUGGUUAACCUCUUU 5 nmol $170 Buy Now
INH0655 hsa-miR-655 Inhibitor AUAAUACAUGGUUAACCUCUUU 5 nmol $170 Buy Now
MIM0656 hsa-miR-656 Mimic AAUAUUAUACAGUCAACCUCU 5 nmol $170 Buy Now
INH0656 hsa-miR-656 Inhibitor AAUAUUAUACAGUCAACCUCU 5 nmol $170 Buy Now
MIM0657 hsa-miR-657 Mimic GGCAGGUUCUCACCCUCUCUAGG 5 nmol $170 Buy Now
INH0657 hsa-miR-657 Inhibitor GGCAGGUUCUCACCCUCUCUAGG 5 nmol $170 Buy Now
MIM0658 hsa-miR-658 Mimic GGCGGAGGGAAGUAGGUCCGUUGGU 5 nmol $170 Buy Now
INH0658 hsa-miR-658 Inhibitor GGCGGAGGGAAGUAGGUCCGUUGGU 5 nmol $170 Buy Now
MIM0659 hsa-miR-659-3p Mimic CUUGGUUCAGGGAGGGUCCCCA 5 nmol $170 Buy Now
INH0659 hsa-miR-659-3p Inhibitor CUUGGUUCAGGGAGGGUCCCCA 5 nmol $170 Buy Now
MIM0660 hsa-miR-660-5p Mimic UACCCAUUGCAUAUCGGAGUUG 5 nmol $170 Buy Now
INH0660 hsa-miR-660-5p Inhibitor UACCCAUUGCAUAUCGGAGUUG 5 nmol $170 Buy Now
MIM0661 hsa-miR-661 Mimic UGCCUGGGUCUCUGGCCUGCGCGU 5 nmol $170 Buy Now
INH0661 hsa-miR-661 Inhibitor UGCCUGGGUCUCUGGCCUGCGCGU 5 nmol $170 Buy Now
MIM0662 hsa-miR-662 Mimic UCCCACGUUGUGGCCCAGCAG 5 nmol $170 Buy Now
INH0662 hsa-miR-662 Inhibitor UCCCACGUUGUGGCCCAGCAG 5 nmol $170 Buy Now
MIM0663 hsa-miR-663a Mimic AGGCGGGGCGCCGCGGGACCGC 5 nmol $170 Buy Now
INH0663 hsa-miR-663a Inhibitor AGGCGGGGCGCCGCGGGACCGC 5 nmol $170 Buy Now
MIM0664 hsa-miR-663b Mimic GGUGGCCCGGCCGUGCCUGAGG 5 nmol $170 Buy Now
INH0664 hsa-miR-663b Inhibitor GGUGGCCCGGCCGUGCCUGAGG 5 nmol $170 Buy Now
MIM0666 hsa-miR-664-3p Mimic UAUUCAUUUAUCCCCAGCCUACA 5 nmol $170 Buy Now
INH0666 hsa-miR-664-3p Inhibitor UAUUCAUUUAUCCCCAGCCUACA 5 nmol $170 Buy Now
MIM0665 hsa-miR-664-5p Mimic ACUGGCUAGGGAAAAUGAUUGGAU 5 nmol $170 Buy Now
INH0665 hsa-miR-664-5p Inhibitor ACUGGCUAGGGAAAAUGAUUGGAU 5 nmol $170 Buy Now
MIM0667 hsa-miR-665 Mimic ACCAGGAGGCUGAGGCCCCU 5 nmol $170 Buy Now
INH0667 hsa-miR-665 Inhibitor ACCAGGAGGCUGAGGCCCCU 5 nmol $170 Buy Now
MIM0668 hsa-miR-668 Mimic UGUCACUCGGCUCGGCCCACUAC 5 nmol $170 Buy Now
INH0668 hsa-miR-668 Inhibitor UGUCACUCGGCUCGGCCCACUAC 5 nmol $170 Buy Now
MIM0670 hsa-miR-671-3p Mimic UCCGGUUCUCAGGGCUCCACC 5 nmol $170 Buy Now
INH0670 hsa-miR-671-3p Inhibitor UCCGGUUCUCAGGGCUCCACC 5 nmol $170 Buy Now
MIM0669 hsa-miR-671-5p Mimic AGGAAGCCCUGGAGGGGCUGGAG 5 nmol $170 Buy Now
INH0669 hsa-miR-671-5p Inhibitor AGGAAGCCCUGGAGGGGCUGGAG 5 nmol $170 Buy Now
MIM0671 hsa-miR-675-3p Mimic CUGUAUGCCCUCACCGCUCA 5 nmol $170 Buy Now
INH0671 hsa-miR-675-3p Inhibitor CUGUAUGCCCUCACCGCUCA 5 nmol $170 Buy Now
MIM0672 hsa-miR-675-5p Mimic UGGUGCGGAGAGGGCCCACAGUG 5 nmol $170 Buy Now
INH0672 hsa-miR-675-5p Inhibitor UGGUGCGGAGAGGGCCCACAGUG 5 nmol $170 Buy Now