If you cannot find the element you wish to study among the over 30,000 ready-to-transfect constructs included in the LightSwitch Promoter Reporter Collection, LightSwitch 3´UTR Reporter Collection, LightSwitch Synthetic Response Elements or LightSwitch Synthetic miRNA Target Reporters, you can clone your elements of interest into our suite of empty reporter vectors. The suite includes promoter, 3´UTR, 5´UTR and enhancer reporter vectors.
LightSwitch vector maps, annotations and other information are shown below under the pLightSwitch Vectors tab.
IMPORTANT: Because all LightSwitch reporter constructs contain the optimized RenSP luciferase gene, you MUST use our LightSwitch Luciferase Assay Reagents to obtain optimal results. (Other luciferase assay reagents are not compatible with RenSP.)
Complimentary Empty LightSwitch Reporter Vectors
To encourage the use of controls, you can receive one free vial of empty LightSwitch Reporter Vector of your choice with the purchase of any LightSwitch Promoter, 3'UTR, 5'UTR, or LR Enhancer Reporter GoClone. Simply include the empty vector on the same order when you purchase and it will be included at no charge.
Name | Format | Cat No. | Price | |
---|---|---|---|---|
LightSwitch™ Promoter Reporter Vector | 5 µg | 32021 | $250 | Buy |
LightSwitch™ 3´UTR Reporter Vector | 5 µg | 32022 | $250 | Buy |
LightSwitch™ 5´UTR Reporter Vector | 5 µg | 32023 | $250 | Buy |
LightSwitch™ LR Enhancer Reporter Vector | 5 µg | 32024 | $250 | Buy |
LightSwitch Promoter Reporter Vector
Our scientists created the LightSwitch Promoter Reporter Collection by using an algorithm to evaluate over 5 million human cDNA sequences in order to identify transcription start sites (TSS) throughout the human genome. Based on these TSS predictions, over 18,000 human promoter sequences of ~1 kb (-900…+100 bp relative to the TSS) were cloned into the pLightSwitch_Prom reporter vector. If you cannot find the promoter you wish to study when you search the LightSwitch Promoter Reporter Collection, you can clone DNA fragments that contain promoter sequences into the MCS of pLightSwitch_Prom in order to measure promoter activity.
View the vector sequence and annotation file (txt) for the pLightSwitch_Prom vector.
Promoter Insert Sequencing Primers:
Forward: TCCATCAAAACAAAACGAAACAA
Reverse: AGTCGAGCACGTTCATCTGCTT
LightSwitch 3´UTR Reporter Vector
Following systematic identification of 3´UTR sequences in the human genome using RefSeq and other cDNA resources, we created the LightSwitch 3´UTR Reporter Collection by cloning over 12,000 human 3´UTRs ranging in size from 300 bp to 3,000 bp into the pLightSwitch_3UTR vector. If you cannot find the 3´UTRs you wish to study when you search the LightSwitch 3´UTR Reporter Collection, you can clone 3´UTR sequences into the MCS of pLightSwitch_3UTR. As cloned fragments are downstream of the RenSP luciferase reporter gene, they become part of a hybrid transcript that contains the luciferase coding sequence fused to the UTR sequence of interest.
View the vector sequence and annotation file (txt) for the pLightSwitch_3UTR vector.
3´UTR Insert Sequencing Primers:
Forward: GGGAAGTACATCAAGAGCTTCGT
Reverse: CCCCCTGAACCTGAAACATAAA
LightSwitch Long-range Enhancer Reporter Vector
If one of the optimized synthetic regulatory elements found in the LightSwitch Synthetic Response Elements collection is not appropriate for your research, DNA fragments that contain long-range enhancer elements can be cloned into the MCS of the pLightSwitch_LR vector, which is immediately upstream of a basal TK promoter that transcribes the RenSP luciferase reporter gene. Changes in luciferase levels can then be measured to determine the impact of the cloned enhancer element on transcriptional activity.
View the vector sequence and annotation file (txt) for the pLightSwitch_LR vector.
LR Insert Sequencing Primers:
Forward: TCCATCAAAACAAAACGAAACAA
Reverse: AGTCGAGCACGTTCATCTGCTT
LightSwitch 5´UTR Reporter Vector
You can clone DNA fragments that contain 5´UTR sequences into the MCS of the pLightSwitch_5UTR vector. Fragments cloned into the MCS upstream of the RenSP luciferase reporter gene will become part of a hybrid transcript that contains the UTR sequence of interest fused to the luciferase coding sequence.
View the vector sequence and annotation file (txt) for the pLightSwitch_5UTR vector.
5´UTR Insert Sequencing Primers:
Reverse: AGTCGAGCACGTTCATCTGCTT