RNA Methylation

make the most of your m6A RNA methylation assays

N6-methylated adenine (m6A) is prevalent in nearly all RNA types and in all organisms from bacteria to humans, and plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. Active Motif manufactures high-quality, assay-validated Recombinant Proteins for m6A RNA Methylation research, as well as antibodies, Assay Kits and reagents for analysis of RNA modifications.

MTase-Glo assay for METTL3/METTL4 Complex m6A methyltransferase activity

MTase-Glo assay for METTL3 / METTL14 Complex m6A Methyltransferase Activity

1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex (Cat. No. 31570) in an 8 μl reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour (0.2 U/μl RRI was added in this system). 5xMTase-Glo Reagent was added to the products and incubated for 30 min. Then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. An SAH standard curve (0-1 μM) was performed following the same protocol.

Name Expressed In Format Cat No. Price  
AbFlex® N6-Methyladenosine (m6A) antibody (rAb) N/A 100 µg 91261 $385 Buy
10 µg 91262 $80 Buy
N6-Methyladenosine (m6A) antibody (mAb) N/A 100 µg 61755 $435 Buy
10 µg 61756 $105 Buy
N6-Methyladenosine (m6A) antibody (pAb) N/A 100 µg 61495 $435 Buy
10 µg 61496 $105 Buy
Recombinant ALKBH2 protein E. coli 100 µg 81129 $425 Buy
1 mg 81829 $2,700 Buy
Recombinant ALKBH3 protein E. coli 100 µg 81130 $425 Buy
1 mg 81830 $2,700 Buy
Recombinant ALKBH4 protein E. coli 100 µg 81131 $425 Buy
1 mg 81831 $2,700 Buy
Recombinant ALKBH5 protein Baculovirus 20 µg 31589 $430 Buy
Recombinant ALKBH6 protein E. coli 50 µg 81191 $425 Buy
1 mg 81891 $2,700 Buy
Recombinant ALKBH7 protein E. coli 100 µg 81132 $425 Buy
1 mg 81832 $2,700 Buy
Recombinant ALKBH8 protein E. coli 100 µg 81197 $425 Buy
1 mg 81797 $2,700 Buy