Cart
Products
N6-methylated adenine (m6A) is prevalent in nearly all RNA types and in all organisms from bacteria to humans, and plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. Active Motif manufactures high-quality, assay-validated Recombinant Proteins for m6A RNA Methylation research, as well as antibodies, Assay Kits and reagents for analysis of RNA modifications.
MTase-Glo assay for METTL3 / METTL14 Complex m6A Methyltransferase Activity
1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex (Cat. No. 31570) in an 8 μl reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour (0.2 U/μl RRI was added in this system). 5xMTase-Glo Reagent was added to the products and incubated for 30 min. Then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. An SAH standard curve (0-1 μM) was performed following the same protocol.
