Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items
Recombinant Proteins & Enzymes

RNA Methylation

make the most of your m6A RNA methylation assays

N6-methylated adenine (m6A) is prevalent in nearly all RNA types and in all organisms from bacteria to humans, and plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. Active Motif manufactures high-quality, assay-validated Recombinant Proteins for m6A RNA Methylation research, as well as antibodies, Assay Kits and reagents for analysis of RNA modifications.

MTase-Glo assay for METTL3/METTL4 Complex m6A methyltransferase activity

MTase-Glo assay for METTL3 / METTL14 Complex m6A Methyltransferase Activity

1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex (Cat. No. 31570) in an 8 μl reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour (0.2 U/μl RRI was added in this system). 5xMTase-Glo Reagent was added to the products and incubated for 30 min. Then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. An SAH standard curve (0-1 μM) was performed following the same protocol.

Name Expressed In Format Cat No. Price  
Recombinant ALKBH2 protein E. coli 100 µg 81129 $425 Buy Now
1 mg 81829 $2,700 Buy Now
Recombinant ALKBH3 protein E. coli 100 µg 81130 $425 Buy Now
1 mg 81830 $2,700 Buy Now
Recombinant ALKBH4 protein E. coli 100 µg 81131 $425 Buy Now
1 mg 81831 $2,700 Buy Now
Recombinant ALKBH5 protein Baculovirus 20 µg 31589 $430 Buy Now
Recombinant ALKBH6 protein E. coli 50 µg 81191 $425 Buy Now
1 mg 81891 $2,700 Buy Now
Recombinant ALKBH7 protein E. coli 100 µg 81132 $425 Buy Now
1 mg 81832 $2,700 Buy Now
Recombinant ALKBH8 protein E. coli 100 µg 81197 $425 Buy Now
1 mg 81797 $2,700 Buy Now
Recombinant FTO protein Baculovirus 20 µg 31572 $425 Buy Now
1 mg 31972 $3,600 Buy Now
Recombinant FTSJ3 protein Baculovirus 20 µg 81189 $410 Buy Now
1 mg 81889 $3,500 Buy Now
Recombinant METTL1 protein Baculovirus 20 µg 81022 $415 Buy Now
Recombinant METTL1 protein, GST-Tag E. coli 100 µg 81059 $415 Buy Now
1 mg 81759 $2,700 Buy Now
Recombinant METTL1 protein, His-Tag E. coli 100 µg 81058 $415 Buy Now
1 mg 81758 $2,700 Buy Now
Recombinant METTL2A protein Baculovirus 20 µg 81027 $415 Buy Now
Recombinant METTL3 protein Baculovirus 20 µg 31567 $450 Buy Now
Recombinant METTL3 / METTL14 complex Baculovirus 20 µg 31570 $475 Buy Now
Recombinant METTL4 protein Baculovirus 10 µg 81177 $415 Buy Now
1 mg 81877 $5,900 Buy Now
Recombinant METTL6 protein Baculovirus 20 µg 81023 $415 Buy Now
Recombinant METTL6 protein, GST-Tag E. coli 100 µg 81061 $405 Buy Now
1 mg 81761 $2,700 Buy Now
Recombinant METTL6 protein, His-Tag E. coli 100 µg 81060 $415 Buy Now
1 mg 81760 $2,700 Buy Now
Recombinant METTL7A protein Baculovirus 10 µg 81178 $415 Buy Now
1 mg 81878 $5,900 Buy Now
Recombinant METTL8 protein Baculovirus 20 µg 81028 $415 Buy Now
Recombinant METTL8 protein, GST-Tag E. coli 50 µg 81106 $405 Buy Now
1 mg 81806 $2,700 Buy Now
Recombinant METTL11A (NTMT1) protein Baculovirus 20 µg 81029 $405 Buy Now
1 mg 81729 $3,600 Buy Now
Recombinant METTL11A (NTMT1) protein, His-Tag E. coli 100 µg 81062 $415 Buy Now
1 mg 81762 $2,700 Buy Now
Recombinant METTL11B (NTM1B) protein E. coli 50 µg 81121 $405 Buy Now
1 mg 81821 $2,700 Buy Now
Recombinant METTL13 protein Baculovirus 20 µg 81024 $415 Buy Now
Recombinant METTL14 protein Baculovirus 20 µg 31568 $415 Buy Now
Recombinant METTL15 protein Baculovirus 20 µg 81084 $405 Buy Now
1 mg 81784 $3,600 Buy Now
Recombinant METTL16 protein Baculovirus 20 µg 81085 $405 Buy Now
1 mg 81785 $3,600 Buy Now
Recombinant METTL17 protein Baculovirus 10 µg 81105 $415 Buy Now
1 mg 81805 $5,900 Buy Now
Recombinant METTL18 protein Baculovirus 20 µg 81030 $415 Buy Now
Recombinant METTL19 (TRMT44) protein Baculovirus 20 µg 81088 $405 Buy Now
1 mg 81788 $3,600 Buy Now
Recombinant METTL21A protein E. coli 100 µg 81122 $415 Buy Now
1 mg 81822 $2,700 Buy Now
Recombinant METTL21C protein E. coli 50 µg 81123 $405 Buy Now
1 mg 81823 $2,700 Buy Now
Recombinant METTL22 protein Baculovirus 20 µg 81092 $415 Buy Now
1 mg 81892 $3,600 Buy Now
Recombinant METTL25 protein Baculovirus 20 µg 81089 $405 Buy Now
1 mg 81789 $3,600 Buy Now
Recombinant METTL26 (JFP2) protein E. coli 100 µg 81063 $415 Buy Now
1 mg 81763 $2,700 Buy Now
Recombinant NSUN1 protein Baculovirus 20 µg 81170 $410 Buy Now
1 mg 81870 $3,500 Buy Now
Recombinant NSUN2 protein Baculovirus 20 µg 81171 $410 Buy Now
1 mg 81871 $3,500 Buy Now
Recombinant NSUN3 protein Baculovirus 20 µg 81183 $410 Buy Now
Recombinant NSUN4 (SHTAP) protein Baculovirus 20 µg 81172 $410 Buy Now
1 mg 81872 $3,500 Buy Now
Recombinant NSUN5 protein Baculovirus 20 µg 81173 $410 Buy Now
1 mg 81873 $3,500 Buy Now
Recombinant NSUN6 protein Baculovirus 20 µg 81174 $410 Buy Now
1 mg 81874 $3,500 Buy Now
Recombinant NSUN7 protein Baculovirus 10 µg 81175 $410 Buy Now
Recombinant WTAP protein Baculovirus 20 µg 31571 $420 Buy Now
Recombinant YTHDC2 (1279-1429) protein E. coli 100 µg 81101 $415 Buy Now
1 mg 81801 $2,600 Buy Now
Recombinant YTHDC2 protein Baculovirus 20 µg 81198 $410 Buy Now
Recombinant YTHDF1 protein Baculovirus 20 µg 31608 $410 Buy Now
Recombinant YTHDF1 (380-533) protein E. coli 100 µg 81102 $415 Buy Now
1 mg 81802 $2,600 Buy Now
Recombinant YTHDF2 protein Baculovirus 20 µg 31573 $415 Buy Now
Recombinant YTHDF2 (401-554) protein E. coli 100 µg 81103 $415 Buy Now
1 mg 81803 $2,600 Buy Now
Recombinant YTHDF3 (407-560) protein E. coli 100 µg 81104 $415 Buy Now
1 mg 81804 $2,600 Buy Now